ZFIN ID: ZDB-TSCRIPT-090929-12753
Transcript Name: ltb4r-202
Previous Name: ltb4r-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000030585 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000030585|OTTDARG00000023476|ZDB-GENE-070705-164 ltb4r|OTTDARP00000046449 CH211-272H9.1-001 LG_ CR847899.28 Danio rerio protein_coding KNOWN, 3752 bp
AGTCTCAGCAATGTCCTTCAGTGCATGTTAGTGCTTTGTT
CTTTCCTGTCTGGAGCAATTGGTTTCTCAAGTTGCTCTTA
AGAGGAAGCGATGACGTTTAAAAAAAAAAAAAAAAAGCCC
CACTACTTAAATGATTTAATGATAAAGACGTCTCACATAC
TGTGTAGATCTGATTGCAATACTGTTACTGTCACGCTGAC
GTTTCTCAGCTACAATATCTGCAAGGAGGTCCATGAGATT
ACACAAGTAAATTCAAGAAGCAACACCATAAAGTTTGATT
CAAATGGCAACTCCTTTAACTCCGGTCTTCTCTGGACCAC
CTGCATCCGCCGTTGTGCCCGCTCCCCCATCTACACCACC
ATCCCTGCCCCTGTCCCATCAGATTGGCATTGCGATCCTG
GTTATCGCTTTTGTGTTTGGTTTTCCCGGTAACCTGTTTG
TAGTGTGGTCGGTACTGTGTCGAGTGCGGCGCCGCTCTGT
CACCTGTCTGCTGATTCTGAATCTGGCCGTGGCTGATGCT
CTGGTGCTCCTGAGTTCTCCGCTTTTCATCCGGTATCTGG
TGGGAGGGAAAGGCTGGGAGTTTGGACCTGTAGTCTGTAA
GACGGTGCATTACCTGTGCTGCGTCAACATGTACGCCTCC
ATCTACTTGATCTGTCTGATGAGCATGGACCGCTGGCTCG
CCGTCACCAAACCATTTCTGTCTCAAAGGCTGAGGACCAA
GAAGAGGCTCCTGAGCATCATGCTGGCCATCTGGGTCATG
GCTTTTCTGATGGCTTTACCCATGCCATTTTATCGCTCTG
TTGTGCAATATAAACCAGGTGTGCCCATCTACCTGTGTAA
CCCATACCACTGGCAGAGTGAATCTCATGAAATCTTTCAG
TACCTGTCTGAGACTCTGCTGGGCTTCCTGCTGCCCTTCG
CCTTCATCCTGTTCTGCTACATCTCAGTCATCCTTCGGCT
GCGCAGCGCCATGTTCCAGCGTAAGGGAAGAGGAAACTTT
CTCATCCTCATCATCATTGCTGCTTTCACCCTCTTCTGGT
TGCCGTATCACCTGATCAACATCATACAGGTGATTGGTGT
GATGCAGGGCTCCTCTTCTTTTCTAAACGTGGCAAAAGTG
GGTCGTCCCAATGTGACAGCATTCGCATTCATGAGCAGCA
GTGTGAATCCAGTCCTGTACGTGTTCGCTGGCAGCTCTCA
CATCCGTCAGGCTGGTTTAGGCTTCATGGCGAAACTTTTC
GAAGGGACCAATTCAGAGATGGGCTCCAGCCGCAGCACCA
GGTCCAGCCGCGGCTCAAATACAGAAAACTCCGTCTTCAC
AAAACTGTCTGTCAAGCTGAATCGCAAAGGTGATGGTGCA
GGAGCCGAGACCCATGATGGAGAAGAGGGGACCTTGGCGG
ACAAGACTCTGACCCCCCTGCACTGAAGTGTTCGTTTATT
CCCTCGAGGCTCATTTATAGTGTTAGTGAAGCTGCTGGAC
TTTAGTTATCCCAACTGAAAGGATAATATCATCTTCTGCT
AAATATAAGGTTTTATTTCTTCTAAGGCTACATCCACATG
AATCAGGAGTTTTTAAATTAAAAAAATCTGTGTACGTACA
AAATCATTGAAACCTACTGAAAATGATGTAGTAAATATGC
CAGAGCAGCATGTGCTACTGCAGTTCTTTCATAGAGATAC
ACAAACAATGGAAAAGACAATTGGTGCATTCCAAACGGGA
CATTTTGCCCTCCGAAGGGTGATTTGAAGTTTAAAAAATT
TAAGACCGCTATATTAAAGTGTCGTTCCAAAACAAAGTGC
TCCAAATTGGCCACTTTGAAGAGCCCTTTGGAATGAAGTA
TTTTGAAGGATATAACTTCCATGAACCTTGTTCCACACTG
TGTTTAATTCGGATGGACTCTTCCCTTTGCTCTAAACCAG
GGGTCAATCTTGGTCCTAGAGGGCCGGTGTGCCTGCAGGG
TTTAGCTCCAACCTGCCTCAAAAAACCTGCCTGGATGTTT
TAAGTATACCTTTAAAGACCTTTATTGGCTTGTTCAGGTG
TGTTTGATTAGGGTTGAAGCTAAAATCTGCAGGACACCGG
CCCTTCAGGAGGAAGTTTGGTGACCCCTACTCTAAAATCT
TCAGAGGGTCACCTTTAAAGGGATTAGGCACAAAGGGATG
AGCCCTTCTGAATGAAACCCTACTGAAAAGCAGGCTGGTT
GGATGGTATTAGCCGGTCAACCAGGCTGGTTTTAGAGGAG
TTTTGGCCACTTCCAGCCCAGCCAAAACCAGCTATGTCCA
ACTCAAACAGGCTAGTTAAGCTGGTTTTAGTTGGTCAATT
TCCAGCCTGACCAGCTAAGACCAGGCTGGAAATGGCTGGA
AACCAGCCTGGAAGTGACCAAACCCATCTAAAACCAGGCT
GGCCAACCAGCTTAGTCTGATTTAAGCTGTTTTTTTAATA
GGAAACCCAGCACTTGGCTGCATTCTAGTCCATCTTTTAT
GAGCTTCACTCGCTAACTTCCCTCCATCTTGTTCCCTCAA
ATGCATGTCATTGATTACATTACACAAGTGTGTACACTGG
TGCAACATCTGTATGGGTTTATATGGAATGCCCTAAACCA
GGGATCACCAAACTTGTTTCTTGAGGTCCGGTGTCCTAAA
GATTTTAGCTCCAACCCTAATCAAACACACCTGAACAAGC
TAATCAAGATCTTACTAGATATACTTGAATCACCCAGGCA
GGTGTGTAGAGGCAAGTTGGAGCAAAACCCTGCAGGGCAC
CGGACCTCCAGGAACGAGATTGGTGATCCCTGCAATAAAC
ACTTCAGCACTTATAAACTAAATTGTTGTGATATCACAAT
AGCACTGCATTCAGGGACATATAGGTGCTGGTTTGGACAT
ATGAAGCTGACTCTCGAGGGTTTGTCCATGTAAATGTTGC
TCATTCACTTAATGAAGTGGAGTACACTTTAAAAATGGTG
GCTAAGATTACCCTGAGGGGAACAAGATAAGAGAAGTATG
TGAGTGCATTTCGAGAAGTAAAGTGGAACACAGCCTCGGA
GCATGAAATGGATCTAACATCATGTGACACACCTTGTTGT
CTATATTGATTTGTTGTTTAACATAGTAGCAAAGGAGAAG
AAGATTTAGCTTCAGTAAAGCTATTAAGCTCAGCAGCTTC
AGCCGTCTGAACACAAGCATGTAGAGTCCGCCGTTGTTGT
TGCTGTTTTGTGACATAGCATCTCTGACTAGGGCAAGATG
TGGGCTGAGGACATCAACGTTTCATAAAATATATGGATTG
ATTGTTCACATGAAAAGAGTTTTCAGATTGAGATTTCAGA
TTTTAGAGCTGGTTTAAAAAAATATAGTGGAGTTCTTCAA
ACTGTGGTTTCGTCTGGATTTCTGGATTTCGTCTGGTTTC
TGTGTGAACAGGGCCTAAATATTTGATTAGGATTCACTGG
AATCCAGGCTTTTAAACATCGTTACATTTTTAGAATTATA
TATATTTTTGTTTATTTTATTTCACAGCTGTAGTTTGTTG
TTGTTTCTGTGCTTCTTTATAAAACTCAAATGTATTTGTA
TATGTGCCCATCCTCATTATTCATCTGATTATGTACACTT
TAGGTTTTGACATTTAGGATGCACAATATTTATATATCTG
ATGTGAAACAGTCGGATGAACTGTCAGTTATTGTGCAAAT
TCAATTTTATTCATTATTGCTTTGTCTTTCACATTAATGC
AAAATATATAGAAAAAGAAAGATTCAAAACTA

ltb4r TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ltb4r-202 3752
ncRNA ltb4r-002 (1) 539
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ltb4r-202 Contained in:
[BAC] CH211-272H9 (1)

Genome Resources: Vega_Trans:OTTDART00000030585 (1),  Ensembl_Trans:ENSDART00000154438 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CA496534 (1) 907 nt
GenBank:EH996714 (1) 845 nt
GenBank:CD604746 (1) 500 nt
GenBank:AL915978 (1) 405 nt
GenBank:CD606702 (1) 331 nt
CITATIONS (2)