ZFIN ID: ZDB-TSCRIPT-131113-4713
Transcript Name: si:dkey-192l18.12-002
Previous Name: dkey-192l18.12-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059855 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059855|OTTDARG00000041508|ZDB-GENE-131127-392 si:dkey-192l18.12|no_translation DKEY-192L18.12-002 LG_none BX005461.9,BX322549.5 Danio rerio antisense NOVEL, 933 bp
TAGCTTTAAAACGTTTTCTATCTCGTTTTACGCTTGGAAA
AACGAAATAAATGCTGAAGTTCATTTAACAGAGTATATTT
TAATCTCATTACAACATCAATAATGTTAAAGGAACCGTAT
GAAATTGAAAACAGTCACATAAACCTTTCACCTGAGGTCT
ATTGGTGCCTGTAAAACACTAGTAGTGCATATAGATCATA
GATAGCTATTTTCAAAGCATGTAGTTGATGCTAATGTTTC
AGCTGTAAGGCATCAAACTCGATTGCTCTAGGGCTGCAGC
TCAAATTGAACACACCTGATGCACTAATCAAATTGATCAA
GACCTCCAGGTGTGATTAGGAGCTGAGTTTGAGATCACGG
CTTTAAAGTAAGCAAATGCATGTCTACAAGACTCTAGGTC
AATTCTGACAATTGAACACACCTGATCCAGCTAATCAAGG
TGATCAAGACCACCTGCTGTGATTTGGAGCTGATGTGAAC
CTGCTGGAGTTGAGTTAGAGATGATGGCTGAAGGTTAGCA
AATTCATGTCTACAAGACTCTGAATTAGTCCTGACAATTA
AACACACCTGATCCAACTAATCAAGGTGATCGAGACCACC
TGCTGTGATTTGGAGCTGATGTGGCCCTGCTGGAGTTGAG
ATTGAGAGCACTGCCTCCATTAAGGAATGAACTGATGTTA
AAGCACCATCTCAGAGAACAGACTGTCAGGACTAAACCCC
ATGAACAACGTCACTGGATTTGCTGGGAAAGAGGCCTTAA
AGACAAAACAACAGAAATGAATGAGCAAAACAGACTACAT
GTACTAAACACCATGGACACCGTGACTGAATTTGCTGAAA
AAGGCCCTGAAGAAGAAGAACAATACACCTAAATGAATTC
ACAAACAAACCCGGTTTTATATTACTGCAAATGAGTGTGT
GAAGGCCAGAGGA

si:dkey-192l18.12 TRANSCRIPTS
Type Name Length (bp) Analysis
antisense si:dkey-192l18.12-001 (1) 332
si:dkey-192l18.12-002 933
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-192l18.12-002 Contained in:
OTHER si:dkey-192l18.12-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000059855 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)