header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-1521
Transcript Name: si:dkey-192l18.12-001
Previous Name: dkey-192l18.12-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059856 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059856|OTTDARG00000041508|ZDB-GENE-131127-392 si:dkey-192l18.12|no_translation DKEY-192L18.12-001 LG_none BX005461.9,BX322549.5 Danio rerio antisense NOVEL, 332 bp
GAATGAACTGATGTTAAAGCACCATCTCAGAGAACAGACT
GTCAGGACTAAACCCCATGAACAACGTCACTGGATTTGCT
GGGAAAGAGGCCTTAAAGACAAAACAACAGAAATGAATGA
GCAAAACAGACTACATGTACTAAACACCATGGACACCGTG
ACTGAATTTGCTGAAAAAGGCCCTGAAGAAGCAGAAGAAT
ACAGCTAAATGAGAATGAACTGATGTCAAAGATGAGCAAA
ACAAACTGCATGTACTAAACACCATGGACACCGTGACTGA
ATATGCTGAAAAAGGCCCTGAAGAAGAAGAACAATACACC
TAAATGAGTGAG

si:dkey-192l18.12 TRANSCRIPTS
Type Name Length (bp) Analysis
antisense si:dkey-192l18.12-001 332
si:dkey-192l18.12-002 (1) 933
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-192l18.12-001 Contained in:
OTHER si:dkey-192l18.12-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000059856 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)