ZFIN ID: ZDB-TSCRIPT-131113-4627
Transcript Name: si:dkey-187j14.6-002
Previous Name: dkey-187j14.6-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059504 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059504|OTTDARG00000041232|ZDB-GENE-131121-572 si:dkey-187j14.6|no_translation DKEY-187J14.6-002 LG_ BX897747.8 Danio rerio protein_coding NOVEL, 630 bp
GAGCGCGGGAGCCATGGAAAATTCCAGATGCCGATGCCAA
CACAGAGCAACTGACAGCGTTTCCCCCCCAGAAACACGAT
ATTGTTCTGTGTTTTTCTACGCACAATAGAGATGTTGGTC
TATATATGGAAGGAAACTGGCTGGTGCTCATCTAATCAGG
ACCATGTGAAGTGTACACTTGTGGTGTGACCTGCTTGGAC
AACACTGGAATACATCACATCCGGTCAGCCAGTCGCATAT
GGTCTAGTCGCAGGAATTCGAGTATTTTAACGTATCCACA
GCTCAAATCAGATCCGAATACGGAGATGATTGGAACTCTA
CGCAGCTCCAGGACTACTCGTCATTGGAAATGAATGACTT
CCGGTCTGTCACTTTTCGTTTGCTGTGGAAAGGCGGCTTT
AGGGTTTACTCACGCTAGGCTATGTGAACTATGCCCAGGC
ACGTTTGACACTAATTTACTGATTCGTTTGACAAGTGTGA
GTGCTCCCAATTAAGCCCAGATGCAGGTCCAGTTCAAGAC
GCTTGTTTCTTATATTCTTGTTTATGTAAAGTACTTTGAA
TTACAAGTGTGTATGAAATGTACTATTGAAATAAACTTGC
CTTGCCTGCATCCCAAACGACTTAAAATAA

si:dkey-187j14.6 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-187j14.6-201 (1)    Ensembl 1320
ncRNA si:dkey-187j14.6-002 630
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-187j14.6-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000059504 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EX157299 (1) 601 nt
GenBank:CO351151 (1) 590 nt
CITATIONS (1)