ZFIN ID: ZDB-TSCRIPT-131113-3035
Transcript Name: si:dkey-187j14.6-201
Previous Names: dkey-187j14.6-001, si:dkey-187j14.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059503 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059503|OTTDARG00000041232|ZDB-GENE-131121-572 si:dkey-187j14.6|OTTDARP00000049231 DKEY-187J14.6-001 LG_ BX897747.8 Danio rerio protein_coding NOVEL, 1320 bp
CAGCGTTTCCCCCCCAGAAACACGATATTGTTCTGTGTTT
TTCTACGCACAATAGAGATGTTGGTCTATATATGGAAGGA
AACTGGCTGGTGCTCATCTAATCAGGACCATGTGAAGTGT
ACACTTGTGGTGTGTAAACAACTCTAAACAACAGAAATGA
TCCAGACAACTCTTCCTCTACTTGTTTTACTAGGACCGTT
CACTGCCATCTTAAGTGACGTCATCCTCATCAATGAACAA
AAGAACTGGACTGAAGCTCAGGCTTTCTGCAGGGAGTTTT
ATTTGGATCTGCCCACAGTTCAGACGGATGACGACAGGCT
TGAGATCCAGAAGGCCTTGAGTGGAGCAAACCCTGAAACC
TGGGTGGGTCTGTACGGCAGCATCTGTGTGTGGCGCTGGT
CATATCGGAGTCAGGATCTGCTGTTTTCAGCCTGGGCTCT
GACTGAAGACCCGAGCCCCAGAACACAGAGTGCATGTGCA
GTTATCAGAAACGATGGATTCTGGTACGCCACCAACTGCA
CACAGCTGAAGCCCTTTGTTTGCTATAGAGGAAATCAGAT
GTTTTCTTTATTTATAAGAACTAATTTGACCTGGATAGAG
GCTCAGAGTTTCTGCAGGACAAAATACGTTGATCTGGCCT
TCATCAGTGGTGTGACTGACAACACTGATGTCCTTAATAA
CTTAATCTGGTATAGCGTGTATGAAGCCTGGATCGGCCTG
AGCAAGAACCAGTGGCTGTGGTCAGACCAGAGCAGTGTGT
CCTGGCCCTCTCTGGGATGGTCTTCAGGAGAGCCTAATAA
CGCAGACGGGAATGAAAAGTGTGCGTTTGTAAATGTGAAT
GGACTGCTCGTGGATGAAAACTGTGACAAAGTCTTTTCTT
TCTTCTGCGTTGTTAAGCGTGTGAAAGCTCAGGTTGTGCG
ACTGGAAGTGAAATCCTCTGCTCTTCTAGATGAATCCGCC
ATCATGTTGGCCATAGAGAAGAAGATGAGAATAATCCTCC
TGAAGCTGGAGACGGACCGCACATACAGCATAACATGGAG
AGCCCAGACTGATGGCAAGACCTTCAAGCCGCTGAAAAAC
AATGCTCGAAACACCACAATAGTCTGTAAACAAGATCAAG
GAGTGTATTTCAAAGGGCCTCGTTAACTTGCCATCAGTAC
TATTGTTAGCACACTTAACCATTTTTTTAAATTGTCTACA
GAACAAACCACTGTTATACAATGACTTGCCTAATTAACGT
AGTTAAGCTTTTAAATGTCACCTAAGGCTGAATACTGGTA
TCTTGATCAATATCTAATAAAATATAATTAGACCCTTTTA

si:dkey-187j14.6 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-187j14.6-201 1320
ncRNA si:dkey-187j14.6-002 (1) 630
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-187j14.6-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000059503 (1),  Ensembl_Trans:ENSDART00000153614 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DT070839 (1) 745 nt
CITATIONS (2)