Transcript

cc2d1b-002

ID
ZDB-TSCRIPT-131113-4546
Name
cc2d1b-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000059120 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000059120|OTTDARG00000024273|ZDB-GENE-030131-1426 cc2d1b|no_translation cc2d1b-002 LG_none BX323588.10,BX511079.9 Danio rerio protein_coding KNOWN, 528 bp
GGCACCGAAAGGCCAAGGAGCAGCTGCCGCGAAACAGATG
GGATTGTTGCTTGATTTCAAGCCAGATGATATGATGGATA
TGGATCAAGATCTGGATGATCCGTCTTTAGAAGCTGAATT
TGCTGCCATTGTTGGGAAGAAACCAAATGTGCCTACCAGG
GCGAAGAAGGCTGGCAAAGGTGGAAAATAGCATTATTTTT
GTCTTTATTTTCTATTTCTGTTATGAATACAGACTGTATC
TGTATAGCCTAACTTTAAAAGGTAGGATTTAAAATGCCTT
CTAATGTATTCTATTATTGTGCAAATGTTGGGATTGTCCC
AAGGTTTGTTTTACTTGGAGGAAGTTGTTCATTACATTGT
CATTTATTTCAGTAGCAGTTGCTTTGTTGACAAAAAACCT
CTCAGATGTACAGACATCATTAATAATGTTGTTATGGGAA
GTAGTGTTGTCAGAAATATTGATATATCGATTAACATTGA
TATTGAAATATTTAAAATAATATCAATCATGCTTTTGATT
ACTATCGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations