Transcript

cc2d1b-203

ID
ZDB-TSCRIPT-090929-13389
Name
cc2d1b-203
Previous Names
  • cc2d1b-001
  • si:ch211-57g18.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031755 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031755|OTTDARG00000024273|ZDB-GENE-030131-1426 cc2d1b|OTTDARP00000025809 cc2d1b-001 LG_none BX323588.10,BX511079.9 Danio rerio protein_coding KNOWN, 5996 bp
CAGCTGGGCGTGGCCTGTCTTGATGTTTTGTTGCATCAGT
TGCAGACAGTAGCAAAACAAACCCAATGTTTTATGTACTT
CAGTGTGTCTGGATTCGTTTTTCTGATATACTCACAAAGG
GTGTTGTTTGCACATCACATAAGCTGTCAGGTTTGTGAAG
CCCTTCGTTGGGCCAGGAAGGAGGAAGTGGAGTGGGTTTG
CTGTTGGCCAGGAAAAGAAAGTTAAATACTCCACAGTTCA
CAAGTGGATCAGGGTCTTCGTTTATTCTGCTCGACATCCT
AAGCTCCAGCCTCCAGGTGTTGGTGTGTGTGCTGTAAAGG
GCGGGGGTCATCGCGAGCAGGACGGGATGTTTGCTCGGAA
AAACAAGCGAGCAGCGGCACCGAAAGGCCAAGGAGCAGCT
GCCGCGAAACAGATGGGATTGTTGCTTGATTTCAAGCCAG
ATGATATGATGGATATGGATCAAGATCTGGATGATCCGTC
TTTAGAAGCTGAATTTGCTGCCATTGTTGGGAAGAAACCA
AATGTGCCTACCAGGGCGAAGAAGGCTGGCAAAGCTCCAT
TGCCAATGGAAGACATTGAAAAAATGGCGGAGGCGTGCAT
GAAAGACTTTGATGATGACGAAGACGAAAGTGTGGAGGAT
GATGAAGACCTTCTGGCTGAGCTGCAGGAAGTGGTTGGTG
AGGAAGAAACAGACGACTCAGGTGCCACAACACCAACCTT
CACTGTTAGTGCAGAAACTCCTGCAGATGCGACACCAGAA
AGCCAGGAAACTAAGGTTTCATCAGTTCCCGGGAGCATCG
AACACACCTTAGAGGAAAGAATAAGCTTGTATAGGATGGC
TGTTACCAATGCCAAAGCTGCAGGGGAAACTTCTAAAGCC
CGGCGATATGAGAGAGGCCTCAAAACACTACAGACTATGC
TGGCGACAGTACGGAAAGGAGGGAAGATTGACGAATCTGA
GATTCCTCCTCCAGTGGCATGTGGGGGTCCCGTTGGATCC
AGTCGGCCCCCAGCCCCTGCAGTGTCCCCTGATGAGCAGG
AAGAGTGTGATAGTGCTGTCGAGATCAGTCCCGTCTCTGC
GGAGGCCGCTCCTGTTGTCATGGATACAGAATCAAACATT
AGAGATGAGTCCTCTGGTGTAACGTCTCCAGCATCACTGT
CATCTCCAGAAGGGGAACACGCTAGCAGTGAAGCTGAAAA
GCACTTAGTAGATTTTCCAGTTGGACAGCCAACAAAAGAC
ACTCTGCTGGAGCAACAGAAGGAGTACAGGATGGCAGCTC
TCAAGGCCAAACAAGCAGGAGACATCGACCAAGCCAAGAT
GCATATAAAGGCCAGTAAGGGATTCGATGCAGCAATTGAA
GCTTTGGAGAAAGGCCAGCCGGTGAATGTGAGCTCTCTCC
CGCCCCCTCTGGCTCAAGTGACTCAAGCTCCACCTCAGAC
AGCTGTTAAAGTCTCGCCTTCACCTTCAGGTGAGACCGCC
TCTGGTCCAGCTCAGCCTAACACAGTTCTTGAGGCCCTGG
AACAGAGGATGGCTAAATACAAAGAGGCCTTCACACAAGC
CAAAGCCAGCGGCGATGAGCGCAAAGCCCGGATGCATGAC
CGCATTGCTAAACAATACCATGCTGCCATACGTGCTCATA
AAGCAGGACGACCTGTTAATTATGACGAACTTCCTGCCCC
TCCAGGCTTTCCTCCAATCCCTGGCCAGAAGGCCACTTCT
CCAGAACAGGGATTGGCTGCTGTGCTGGAAACAGCCAATA
AGCTGACATCCAATGAAGCTAGAGATGGTCAAGACGAAGA
TGAGGAGGAAGAAGAGAAGGCTTTAAACCTAAGTGGCCAA
AAGAAGCCCACTCTTGTAGTGCAGCCAACAGTACAGGAGC
CAAAACAAAGGACCCCTTCACCAGACAGAACGTCTAAAAG
AGGAAGTCTGCCTGACGCTGCTCAGCAGCAGCTAGAATTT
CTGGAGGGCCGCAAAAAGCAGTACATGAAAGCAGCGCTGC
AGGCAAAGCAGAAGAAAGACCTAGAGCAGGCCAAGACTTT
TCTGCGCACAGCCAAGGGTTTGGAACCCATGATCGAAGCT
GCCCGCAGTGGGAAGACTGTAGACGTGAGCAAGGTACCTT
CACCACCTGGAGATGAAGACGAGGACTTCATTCTGGTCCA
CCACAGTGATGTTCAGCTCTCTGAGAAGGCTGAGGAGGTC
TACACTCAACTCAACAAACTGCTCAATGAGCAGCACGAGA
AATGTGTGACATATTCCAAGCAGTTTACACACTTAGGGAA
TGTTGCAGAAACAACCAAATTTGAGAACATGGCAGAAAAG
TGCAAGAAGAGCCTGGAGATCCTTAAACTGGCACAAAACA
GGGGCCTTCAGCCTCCTAAACATCATTTTGAGGAAAGAAC
ATATCGCACTGTCAGGATCTTCCCAGAGCTCAGTAGCACA
GACATGGTTGTGGTCATTGTTAAAGGGATGAACCTTCCTG
CCCCCTCTGGTGTTGCAACAAATGATTTAGATGCTTATGT
CAAGTTTGACTTTCCATATCCCAGTTCAGAGCAACCTCAG
AAACATAAAACGGCAGTCGTCAAAAATACCAACAACCCAG
AGTATAACCAGAGCTTCAAGCTGAATATCAACCGTAACCA
CCGCGGCTTCAGGAGAGTAATACAGTCGAAAGGCCTGAAG
CTGGAGGTGCTGCACAAAGGCGGATTTCTGAGGAGTGATA
AGCCGGTAGGAAGTGCCCAGATCAAACTGGAGAAGCTGGA
AGCTCAGAGTGAAGTCCGAGAGATTGTAGAGCTGATGGAT
GGACGGAAGGCCACTGGGGGTCGTCTGGAGGTGCGGGTGC
GTCTCAGAGAGCCTCTGGGTGGGCAGGAGCTCCAGACGGT
CACTGAGAGATGGGTAGTGCTGGAAGAGCCACAGGTGCTG
CTGTAACTGACACTATGATTCATCTTCTCAAAGTCTTGAG
TGCTTTTGTCGGTGTGGATGAAGTTATAGATGGTGGAAGT
TCAGCACTGCTGCTAGCCTCGGGTACGAAAATCACACCAC
AGAGATCCTGAGGAGCTTTCCCATCATGCTCTCTGTGCTT
CCAGACGCTCACAGAGAGACATTTTCTCTGACAGACAATG
TTAGCCTCGTCTTTATCAGGGTAAAGAAGGTTGTGCCACG
GTGTAACACTTGGGGTGATTATTAAAAAAAAAAAAAAAAC
AGGAAGAGAAGGCAAATGTGCCCAGAGATTGAAATGCCTT
TTATACGGCCCTTTTGAGATAGATTGCCTTTTGATTTTAT
AATAACGCTTCCCCCAACTGTTACATTAATGCATTGGAGC
TGAAGCCAATGAGAGCTAACCTTTTTTTTTTTTTACTGCT
CTGGGATGCACTTATGCACTAATGCCAAAGTAATTACTGC
TGCTGCAGTAAGATGAATGACTCAATCTGTTCTCCCTGTT
CCAGCCATATCTCCAGTACTAATGTATGACTGCTATGCAA
ATCAGTTGTATGCCATTAACTATGCAAAAAAAAAGGTTTG
TGTTTAAACCCCAAACATTTCAAAACTTGTTTTATACCCT
CTGTGAGCTGACTGCACAGTTTATTATGGATAGGCTGTGT
CTAAGTACTGCTGTTAAATAGTATGATTCATATATATACT
GTATAAATAAATAAATAAAAATATATTATTTGAGCCACTA
ACAAGCTTTACTAATTGGAACAGAGGTAAATTATTCATGA
TCTGAACGGTTTGTCTTTTTTAGTGTCTTCTTTAATGGGT
ATAAATGGATGTAAATCTATCTCTTTTTTTCAGTATAAGC
TTGAAGGGTCAGTTTACCTAAAAATTGTAAACCTCTATTA
TTTATTCACCCTTATGTCATTCATTTGCTCATTTTCAGTA
TAGAATAGAAGTATTTTAATACAGTTCTGTCTGTCTTCTA
CAGGTCTGTTCTCCCAAAATATTGAAGGCTATATAAATAA
AGATATAGGAATGAAAACTAATATATAAGATATATAATTA
AATAAATCCTTATTAATCAAGTGGTTTAATCTGAAGCCTG
GTTTATACTTCTGCGTCAAGTGACCGGCGTAACCCATGCC
GCATGCAACGCACGTAGCTGTGCATTTATACTTCTGCGCG
CTGTCTCTGTTGGTCTGCATTAACACTTCTGAAAAGCAAG
TTGGCAGTGAGGTGTTTATATTCCTGTGTGTCGAGTTTCT
TCACTGCTGTTTTGTTTTTTCTAAACGCTTCCTGAATGTA
CTAGTGGCTCAAACTTGCCCATTTTGAGGCAGGCACCGAC
AGACATGCAACAACTTTAACTGTGATTTAAACACAAAACA
AAACTTTCCATCCGGCGCTACTTCACGGGACTCCACACTT
TTAAACAATCACTCCATCCACTCGCGCGGCTCTCGTTCCC
GCCCTGACTCGTCAGCGCTACCAAGCCGACCAATGACAAA
GCTTGCGCTACGCGCCGTTGCGACATGTTGTTAAATTTTT
TTGAGAGATGCACGTCAGCGACAGCCACGGCGTAGGGCTA
TGCTCCAACGTGTAGGCTGCGCCTTAGCATACGCGTGCGC
TTGACGCAGAAGTATAAATCAGCCTTAAGCCTGTTGAGGA
AAAAAAAAAAAAAGATCAAATTGGTTATTTAAACATGCCA
TATAATTCAGGAATGAACCACACTGGGTCTTCGTAAAGAC
TCAAACGTGCTCTGCAGAAATGAACCTGATTGGTTCTTGC
GTAAGCTCAAAGGTGATGTGCGACACAAAAGCAAACTTCA
CTGGCTTCCACTGGTTCCTTTTAAATGTGGTTCTTTTGAA
AGCTCAAATGTGCTGCATGACACAAGAATGAGTCTATTGG
CTCTTAAAGAAACTCAGATGTGCCATGTGACAAATAATGA
CTCTCATTTGTTCTTTCAAAAGCTCAAAACATGCTGGATG
CTGCTAGAAAGCCTCGTTGGCTCTTGAAAACACTTAAATA
TCACAAGATACCCAAGAACAAACCTCATTGGAAAGCTGAA
ATGTGCTGTGGGACAGGATTTTGTGTAAACTCAAACATGT
CGCGTGACACGTAGAATGGACCTTATTGGTTCTTGGTGAA
GCTCAAATGTGACGCATGAAAAGAAAGAACTTTGTTAGCT
TCATTACGTGTTATGCAAGAACAAACCTCGTTGGTTCTCG
TGAAGACGCAATTGTGCCACAAGAACGAATCTCGTTGGTT
CTAGTGGAAATTCAAATGTGCTGTGTGATGTAAGAATAAA
CGAATATCTGTAGGATTTAACATGTCGAGGGTGAACAAAT
AATAAGGGGATTGACATTGGGGATGAACTCTTTAGCCTTT
AAACAAGCTCCTCCAGCACTTTGAGACAATCACTCAGACT
AGATCTGGTGCTGTATTTATGTACACATTTCTTGATCAGA
AGAGGCAGTCGAGTTGACATTATAAAGTAGATTTTGTAAC
ATTCTGTCTTGTATATATGTTAACCTTCCCTTACATAATT
TATGAGAGAAATCTATTAGAAACTACTCTTCTTGCACTTT
TGACGGTTGATCCTAGTTGACACTTTGGCCATTGTGGTCT
AGTGCGCACTTAAAGTTATTTTATTGACACACATAACCAT
TGATTTTATTAGCCATTGTAGAGACCTCAGACTGGATTTA
GTTTTCAAGTGCAAAAATACCTCATTTTTGTTTCATTTAA
GTTTTGAGAGAAATCCCTGACTGACATTTTGGCTTTTAAA
TGTAGACCATGGCGTGTTCATTCATTTCATTAATTCCTGT
CTCGTGAATGATGTGGTTTGGCACATTTTTCAGTTTGAGA
TCGTGGTTGAAATCGCACTGTCAGTGCTGATTCTTAGTTA
AATGGTTATTTGATTCTGAAAAAGCCAACTCTCAATTGTC
AGTTCATGTCACATGAGCAATAATGTTTTACTTATGTCCT
GCTGTTCTGTCTACTTTTTTTTGCCCATGCCATTTATTTC
TGTTTCATGTTGTTTGCTATTAAATGAAGAAACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations