Transcript

phox2a-201

ID
ZDB-TSCRIPT-131113-4492
Name
phox2a-201
Previous Names
  • phox2a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057933 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057933|OTTDARG00000040374|ZDB-GENE-000223-14 phox2a|OTTDARP00000045369 phox2a-001 LG_ CU633849.9 Danio rerio protein_coding KNOWN, 3891 bp
CGGACACCAACTTTATTATAAACACACACCGCGAGCCGCC
CGGCGCTCAGAGCACCGGACACCGGGACCTGACACTCGCA
CAGCCGCCCGTCCGTCCACATGTACAAAATGGATTACTCG
TATCTGAACACGTATGACTCGTGCATGGCGGCGATGGAGG
CGAGCGCGTACGCGGACTTTAACTCCTGCAGCCAGAGCAA
CGGCTTCCAGTACAACCCGATCCGCTCCGGCTTCAGCTCC
GGCCCGGCCTGCGCTCCGCTCGCCACCGCCAGCTGCACTC
TGGGCGCGCTCCGGGAGCACCAGCCTGCGCCCTACTCCAC
AGTGCCGTATAAGTTCTTCTCGGATGCGTCGGGTCTGAAT
GAGAAGCGAAAGCAGCGTCGGATCCGCACCACATTCACCA
GTTCCCAGCTGAAGGAGCTGGAGCGAGTGTTTGCTGAAAC
ACACTATCCTGACATCTACACACGCGAGGAGCTGGCGCTC
AAGATCGACCTGACGGAGGCACGCGTACAGGTCTGGTTCC
AGAACCGAAGGGCCAAATTCCGCAAGCAGGAGCGAGCGGC
GAACTCTAAAGCGTCGAGCAGCTCTGGCGGGAAGAAACCC
AGCGATGCGCGCTCTTCATCTGAAGACGACGAGTCCAAAG
AGTCGACCTGCAGCCCGACGCCTGACAGCACCGCTAACAT
GAGCAGCCCCGGGGCCCGCAGCAGCCTGAGCCCCAGCCCC
GCCCCTGGCCCCGCCTCCACCTTCAGCCCCGCCTCCATCT
CCCCCGCCCTCAAGAGCTCACCCTGGCCCAGCCTGGGCTC
TGGGACCCCGGGGCCCACACACACGCACACGCAGGAGCTG
CTGAAGGCCTGGCAGCCGGCGGACAGTATGAGCGGACCCT
TCGCCGGGGTCCTGTCCAGCTTCCACAGGAAAAACAACAC
CATCAAGAGCAACCTCTTCTAGAGCCCCGCGCTGACTCTG
GACTCGCTCACAGTAAAGACTCGTGCACAACGCTAGCGTT
ATCACTCGCGTTTATCGTCAGCGTTTGTCGCTCGCATTTA
TCATCTGAATTTGTCGCTCACGTTTATCGCCCGAGTATGT
CGCTCGCATTTATCGTCATCATTTGTATCTCACGCTGATC
ATCTGAGTTTGTCGCTCTCGTTTTTTATTGTTGTTTGTCG
CTCACATTTATTGTCTGAGTTTGTCGCTCGCATTTACCAT
CTGAGTTTGTCACTCGCGCTTATCACTGTTTTTCGCTCGC
ATTTATCGTCTGAGTTTGTCACTCGCATTAACAATCTGAG
TTTGTTGCTTGCGTTTATTATCAGCGTTTGTCACTGCCGT
TTATTATCCGAGTTGACTTTTTCGCTTGCATTTATTAACT
AAGTTTGTCACTCGTGTTTATCACCACCGTTTGTCGCTCG
CATTTATTGTCTGAGTTTGTCGCTCGCATTCACCATCTGA
GTTTGTCGCTCGTGTTTATCATCAGCGTTTGTCGCTTGCG
TTTATCATGAGTTTGTCGCTCACTTTTATCATTGAAGTTT
GTCATTCACATTGTCTTCAGCATTTGTCGCTGGTGTTTAT
CATCATTATTTGTCACTGGCGTTTATCATCCGAGTTTGAC
ATTCGCATTTATTATGATTTTGTCGCTTGCGTTTATTATC
AAAGTTTGTCACTCACATTTATTGTCGCTCGCATTAACAA
TCTGAGTTTGTTGCTTGCGTTTAATATCAGCGTTTGTCAC
TGCCGTTTATTATCCGAGTTTGACGTTCGCGTCTATCATG
AATTTGTTGCTTGCGTTTATGATGACTTTGTCGCTCGCAT
TTATTAACTAAGTTTGTCGCTCGTGTTTATCATCACCATT
TGTCGCTTGCATTTATTGTCTGAGTTTGTTGCTCGCATTC
ACCATCTAAGCTTGTCGCTCGCGTTTATTCGAGTTTAATG
TTCGCATTTATCATGAGTTTGTCGCTCGCGTTTATGAACT
AAGTTTGTCACTCGCGTTTATCATCAGCGTTTATCACTCG
CATTTATTGTTCGAGTTTGTTGCTCACATTAACCATCTGA
GTTTGTTGCTCGTGTTTATTGTCTGAGTATGTTGTTCACA
TTTATCGTCAGTGTTTTTCACTTGAATTTATCGTCTTTGT
TCACTCTCGTTTATTGTCAGCATTTGTTGTTTGTGTTTAT
CATCAGCGTTTGTCACTCTCGTTTATCATCTGCGTTTGTC
ACTCTCATATATTATCAGCGTTTGTCACTCTCGTTTAATC
AGCGTTTGTTACTCGCGTCTATCTTCAGCCGTCAGTAATT
GTTTTACGGGTGAGTGAACATGCAAAATCACTTCCTGACA
CTAGATGGTGCCTGATAAAAAAATACTTAATAAGAAATAC
CAATGCAATGCCACAGCAATTCGTAACTTTTTAATTTTTA
AAAAGCTTTACTTTGATGCGCTTTAATATGATAAGTATAT
ATTAATTAATACACACAAACACCTGAGCTGCATGAAAAAT
TGAATACTAAAGTATGTACGAATTCCGATGTAATACTGTA
TTTGATTTTGACTTTACTTTTACTTTACTGTCTATATAGT
ATGAAAATTAATAGAATGAATGGAATTCGAATGTACTAAT
GTCATTTGTCGTTATGACGTGATCTATCTACGTTAGTAGC
ATCACTTTACTCAAATTGTTGGTCATTTGAGTACTTCTCG
CCTGCTGTTTTTTTTTCCGAATACTATATATTCGAATACT
ATGTTCATTTTTGCATACTATATAGTAGGGAGGGATACGA
TTTGAGCCTCAGCCCTATTCAAATATTTGCAGGAAAAAGT
CGCGTGCCATGAAATAAAATTAAACAGAGCTCAGAACAAA
TTTCTGCGTAATCGGCTAGATCGTTTTGTGCTTGAGTGCC
ACCAAGTGGTGTTTTAGTGTAACTTCAACAATGAACAAAA
GCTGCAATCTCATTGGTTGGACAGTTTTTAAGTGTTTTTT
TTTTTAAATAAACGACAATTTTTTGTCTAGGGTTTTGTGC
ATTTGGTGTGCACGCTCACATTAGCGCTCTTCGTTTAGTC
GTGAGGTGTTAAACGTCGACGATAATCGTGCGATAATAAT
CATGGTGTGCACGAGTCTTAAGAGTTCACTTGTTCATCTG
TTAATGCATTATTATTATTATCACACATCTTCTGGCAGAC
GTTCAGTTAGAAGCAGGTTAACTGTAGATATACTGCCATC
CAAAGGCAGAGCGCAGTAGCTACACTTTGTGTCTTAAAGG
GACAGTTCACCCAAAAATGTGAACCATTGATAGCGTCTAC
ATTTGGTAGATGTGAATTAAATGAGAAGTTTCAACCGTAA
AAAACATGATTTAATGCAGAAACAAGCAAACATGATGGCC
AGTTTCATCTTAATGGTGCATTAACTGATGATCCCAGATC
AGCTCTTACTGTACGCTGATGTGCTTTACTTACTGTCCTG
TCGGCACTTCTGTTCAGTGTGTGTGTGAGAGAGATGTTTG
TGTGTTTGCATGAATGTGTAAGAGAGAAATTGTGAGTGAT
TGTGTGTGTTTGAGTGTGCAATGCTTGTTTCTGTGTGTAT
TTCTGTCTATAAGAGCGAGCGAGACGAGTGTGTTTGTGTT
TATTTGTCTAAGTGTGTGTGTGTGACCCCAGAAATAAGCG
TAGTTAAGCCACATGTAGTTAATTTATTAAAGAAAAAAAA
AAGAAAAAAACTAAACAAAAACTGTTGGGAAGGTCAGATG
ATTTTTTTAAGCTAGGCTTTTATTGAGAAATATTTTGTAA
ATATTAATATAAATACGATGTAGGTTTTTTTATGTTTTCT
GGCTCCAGTGCACGCCATTGTGTTTCCTGAATGACCTGCT
GTATATATTAATCAAAAAAGTCACTGAATAAAGACACTGA
GAATCAATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations