Transcript

sik2b-201

ID
ZDB-TSCRIPT-131113-4371
Name
sik2b-201
Previous Names
  • sik2b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057328 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057328|OTTDARG00000039963|ZDB-GENE-071012-1 sik2b|OTTDARP00000044930 sik2b-001 LG_none BX572648.16,CR854908.5,BX572077.7 Danio rerio protein_coding KNOWN, 5231 bp
CCCTGCGGCCTGTCATTCCTCGACTTCACACAGTCAGTCT
GTCAGTCTTGTCTTTTTTTTCACAGCCCGCGCGCTCAAGC
AAACACAGGCAACGAGCTCTGTCCGCTGACGTAAGAGCTG
GCTCTGGTCGTCCTGGTAACGAATTGGCACCGGAGTGTGG
AAGCGCCTCGAGGCCCCGCCCCCTGTACAAATACCCCCCT
CGGCTCTGACGTCAATTCACGTCAGCCGGAGAACATGATG
CCTCCTGCGAGTCAACTCGTGGACTCTCGCAAACACGGCT
GAAATATTAGAGCTCTATTGTACCGGAGGAGCTGGCGTGA
CTCCTCAACACGCTTTGCTGGTCCTGCTGAAGACTGGAGC
GGACGGGCGCCGGGCACCCTGGCAGGCACGCTGGCATTTT
CGACACGTTTTAGCCTCGTTATCTTGAGGCTCCAGCGGCA
GGTCTCTATCTCGTCACCCCGAACCCTGGCGTTTCACTAA
CAGCATGGTCATGGCTGACTGTCACCAAAAGCCAGCAGCG
CTCAGGGGTCCCGTCCGGGTGGGCTTTTACGACATCGAGC
GGACTCTCGGAAAGGGCAATTTCGCGGTTGTGAAACTGGC
TAGGCATCGCATAACTAAGACCGAGGTGGCTATAAAGATC
ATCGACAAGACCCAGCTGGATGCTGTAAACCTGGAGAAGA
TCTATCGTGAAGTGCAGATCATGAAAATGCTGGACCATCC
GCACATCATTAAACTGTACCAGGTCATGGAGACCAAGAAT
ATGCTGTACCTTGTGACGGAATACGCCAAAAATGGGGAAA
TCTTTGACTACCTAGCCAAGCATGGACGGCTGAGTGAACC
AGAGGCTCGTCGCAAGTTCTGGCAAATTCTGTCTGCTGTC
GAGTACTGTCACAATCGTAACATCGTTCACCGGGACTTAA
AGGCTGAGAACTTGCTGCTAGACGGACACATGAACATCAA
GATTGCTGATTTTGGCTTTGGAAATTTCTTCCAGTCAGGC
AAGCCTCTGGCCACATGGTGTGGGAGTCCTCCATATGCGG
CCCCAGAGGTGTTTGAGGGACAGCAGTATGAGGGACCGCA
GCTGGACATCTGGAGTATGGGGGTGGTTCTGTACGTGCTG
GTGTGTGGCGCCTTGCCCTTTGACGGCCCCTCTCTCCCTG
TCCTGCGGCAGCGTGTTCTGGAGGGCCGTTTCCGTATCCC
TTACTTCATGACAGAAGACTGTGAGCATCTGATCAGGCGG
ATGTTGGTGTTAGACCCCTCCAAGCGTCTATCTATAGGAC
AAATAAAAGAACACAAGTGGATGGTGATGGAGGTGCCTGT
GCAGCGACCGATGTTGTACCAGCAGACCACAGAGGGAGAG
GCTGGAGTGGGCGAATACAACGAACAGGTGCTCAGGTTGA
TGCACAGCCTGGGCATTGACCAGCACAAGACTGTGGAGTC
TCTTCAGAATAAGAGTTACAATCACTTTGCTGCTATCTAC
TACTTGCTGGTTGAGAGGCTGAAGGCCCACCGCTGCAGCT
TCCCAGTGGAGCCCAGACTCGACGCTCGCCAGAGACGCCC
CAGTACGATCGCAGAGCAGACCCTCGTCAAGGCGAGCAGC
GCTGCCCCTCAGGTGAGCCTCCTGCCTCAGAACGTGCGTC
TCCTGCGGCCTCCTGCTGTGCCTCAAACCTCTGCAGACTC
CTTCACTTTCCCACAATCCTCCTGCGCTGCGGAGCACAGC
CTCATGGAGGAGGAGGAAGTCGGGACTCCCAAAATCAACG
GCTGCATGCTGGACCCCTTGCCCCCCGTGGCCGTTCGCAA
ATCCAGCGCTTCGTCCCCCAGCAACATGATGGAGACGTCT
ATAGATGAGGGTATCGAAACGGAGGAGCCAGACACAGAGG
ATGATCATACCCACGTTTTTAACGCCTACCAGACGGCCCG
CTTTGGTCAGCGCAGACACACACTATCTGAGGTCACCAAC
CAGCCAGGGATCATTACAAGTGGAGGTAAACTGTTCAGCA
TGGGTCATAACCCCTCTCTGGGTAGCGTGGACTCAGAGTA
TGATATGGGCTCCATGCACAGTGACCTCAGTCTGCTTGAA
GACGGGCCCTCTCTTAATGAGGTGGTCCTGGCCAACACAC
CAGTGACCCGCTTGACTCCACCGTTCATCAGTGCTCGGCC
CGCGAACCCCACCATGCAGGCACTGAGCACCCAGAGGAGA
GAAACGCACAACCGCTCTCCCATCAGCTTCAGAGAGGGCC
GCAGGGCTTCAGACACATCACTCACACAAGGCTTGGTGGC
CTTTAGACAGCACCTACAGAATCTGGCACGTACCAAAGGT
ATCCTGGAGCTAAATAAGGTGTACGCGCAGATGGGCTCTG
GAGAAACCCCATCCCTGGGGCTGCTGAGCCCTCAGGCCCA
TCCACATGGCTTACTGGACCCTGCACTACAGGAGGAAAGA
GGTCACCAGCCTGACATTGCTCTATGCTCAGGTGGAACAC
ACCCTGCTCTATTATCAAGGAGACAGAGTCTGGAGCCGCA
GTACCTCCCCCACAGAATACAGAAAGCGACTCTGATGGCC
AACAGCCCCAGCAGTTGCCAGATGTTCTGCAAAGAAACTC
CTCGCAGTCTGGAGCAGCAGCTGCAGGAGCACAGGCTGCA
ACAAAAACGTCTGTATCTGCAGAAACAAACCCAAATGCAG
GCGTACTTCAACCAGATGCACATTGTGGAGGACCCTTTCG
CTCCCTGTGCAACCATGGGCCACCAGGACTCCGGAGCCCC
ACCTCAGCCACAGGGTTCACTAGCACCAGCACATCAGCAG
CCGCAGAGCTCACCTCCATTTGCACACGCACAGCCACTTG
GCCCCCTAATGGAGCCAAACCCAGAAGCCCTAGCGTATGA
AACCTACCTGGGCCTTTACCCTCAGCTGCAGCCTCTACCA
CAAAGCTACCCCGCTCAACTGCAACAGCCTGAACCCCTCA
ACTACACCTATCCACCCTGTGACCCAAGCCACTCGCCATC
AGGAGAAGCACTGTACCCGGAGCAATACGACTACCCTCTT
GATCCAGGGCAGCTGCCTCCACCTGCAGAGGTCAGCACTG
CTGGCTATGAAGGCCTGGCATTGGGCGACCCATTTCTGGA
CAGCGAAATGATGGAGACGGTGGACTCTCAGCACGGTTTT
GTGCTGGTGAACTAAGCCGAAACTCGAATAACCAGTATTA
CCTTGATATCTGACTCACTACGGGATGAATTGACGGATGA
GATGACGTCACAGGGATGGATCGAGTTTTGTATGTTGGAC
GTTTAGGTTAAGGCGACCGTTAGCTTGTAATCTTCATACT
TCTACGAAACTCTTTCCTACCTCCCTCCTCGTTCTCCAGT
GGTCCCACCTGCTGCTCTTTCACAATAGAGTGCCGGATGG
TGTGGCGATTGGGCCAGCCACGTTGGCGGCTCACCTCCTC
TCGCCTCGGAGCCGACCGCAGGATAGGAGCTGCTCGCTAC
GCGCCATATGTAGCACAAAGACAGCCTAGATCTGCAATAC
AGAGCCTGCTCGACAGCACAATTAAACATTGACATGTTTT
GTACTGAACAAATCACTCGAAAGCATCGGACTTTATGAAA
GACTAGTCGTGTGCACTCTGTAAGTGCAATGTTAGTTTAA
AACAAATGGCAATAGAGAAGCAATATACTGATTCATCTGG
AACTGAAAAAAAACAACAAAAAAAAACAAGCCATAAGTAG
GAACTACACCACCCGAAATTGCTATCAACGGATGTTTCTT
CTGCACGGCTCAAGTCCAAACCCACAGATACTTGCGGATG
AAGCTGTGATTTAAATAGTTTTTTACATTTTTTTCCCCCA
CTGGATTTCCTTCTCACACTCATCCTAAAAGCCCTAAGAA
TAACAATTAGTTCTCCTCGAACCACAACAGTGTTATTTTG
CTTGCTAATATCACAGTTCCTGTGAATCGGCACACAAATT
GGCACACCTTGAGAGGAAAGTTCTGACTTTCTTTACATGG
TGATGATTAATGAGGAGCATTCATGGGTGACGTAGGCATG
TGTTTAAATGATTAAGGGAATTCAATCCTAATTATTTTTC
TGGGATTTCCCCCTTTGCATTAAAGAAAACATCAGCATTA
ACGTTTAGTCACAAGACACTGGATTGTTCGGCCAATTCAT
TGAATTTTAAGACAGAAAACAAAAGGTTGTTTTTTGTCAG
AAGCACTTAGTAAATCTGTTCTACTTGAAATGACAAGTCT
GTGACTAAACTCAGATTTCAGAAACTTCACAGAGAACGAT
CGCAACCACAAATTGATCGCAAAATTTAGGCGCTTTGTAA
CAGAACACTTATTAATGCAGATATGATACTGGAGCACTTT
GACAAGGAAGCTAAAGGAAATGTAGCTGAGGAGACAGCAG
ATGGGTGAGGTGAACCTGCTCTGCTAGTTTCCTTAAGTAA
GTGACACAAAATTCATCTCTTTCCAATAACGTGCTCCCTG
TGAGCCAGCGCTCTCTCGCAGAAGGATACGGAGAGAGTGC
GAAGTAGTGATTCTTTTGTGTAACGTAGAGGTTAGAACAT
TTAAGTGCTTTCAAAATGCAACCAATTTTGTATTTAATGT
GATAGTGTTCCGTGTGCCTTTTTCTTCGTTCTTTTAAGTT
AAGATCTTAACGAAATAATCCATCTAAAATTGAACATTCT
GTCTTCATTTACTCTCCCTCATCATGCTGAATCAAATCTG
TAAGTGTTCTTTTATAAAACATTTAATGGCATCTAAATAG
GTGCAAAAGTAGCATTATGGTGAAATTGAAATGACACGAG
GGTGAGTAGATGATGAATGTTCACCTTTGGGTGGATTATT
CGGTAATGAGTTTGTTTATCGGTTTGATTCTGTTGGTATT
GTTACAGGATGTAGACCCAGGTTTTACAAAGGTACAAAAC
CAAAGTCCCCTCAGAAGAATTCCTGTATAACCCCACCGTG
TGGAGTTCGGAGCTTCTTGGTCAGCTTTGTAACAGTGCTT
TTCTTTTTGGTCAGTCAGATCAGTATATGCCGTTGAAAAG
TATTAATAGCAATATTTCTTATCAATAGTTCAGAAAGAAC
AGATTAGTGAATGTGTTGCCGTATCATAATCACACCTCCT
TGTTGGCGAGCACCATTCCTTAGACATCCTACAATCTACA
TTTACCTTCATGGTTGTTGACCACACATAAGCTAATGTGC
TGTTAAAATAAAAAAAGATTTATTGAACAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations