Transcript

sik2b-002

ID
ZDB-TSCRIPT-131113-1179
Name
sik2b-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057329 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057329|OTTDARG00000039963|ZDB-GENE-071012-1 sik2b|no_translation sik2b-002 LG_none BX572648.16,CR854908.5,BX572077.7 Danio rerio protein_coding KNOWN, 804 bp
GCAAATTCTGTCTGCTGTCGAGTACTGTCACAATCGTAAC
ATCGTTCACCGGGACTTAAAGGCTGAGAACTTGCTGCTAG
ACGGACACATGAACATCAAGATTGCTGATTTTGGCTTTGG
AAATTTCTTCCAGTCAGGCAAGCCTCTGGCCACATGGTGT
GGGAGTCCTCCATATGCGGCCCCAGAGGTGTTTGAGGGAC
AGCAGTATGAGGGACCGCAGCTGGACATCTGGAGTATGGG
GGTGGTTCTGTACGTGCTGGTGTGTGGCGCCTTGCCCTTT
GACGGCCCCTCTCTCCCTGTCCTGCGGCAGCGTGTTCTGG
AGGGCCGTTTCCGTATCCCTTACTTCATGACAGAAGGTGA
GACACTCTCATCGAACACAAAGCCACCACCACCACAAACA
GTTTTCTGGCGGCAGTTGTTGTTTTTTCACAATATTCTAA
CCCGAAAGTGATTCAAGTCAGTTAAAGCATTCCATAAATA
CTTTGGCTACAGTTTGTGTGCGACTGGACTGTATAAAGAG
AAACGGTTCCAACTGCAGAGTAACATTTCCATTTCACATG
AGTCATGATGGTCCATTATTAAACTAGTAACTGACTAGCC
TGTTAGAGAGGTCAACTGGTAGGGATACACTGTTGTAACT
ATTTTTTTGTTCTGTGGATGAACCTCAATGTCTCAACGTA
GATCTATTCCTTGAAGGACTAAAGATGATATTTTAATGCT
TACAGTAGGGGAAAAAGGAGACTCATTTTGAGGGTTTTTA
AATTAGTTTTTTAATATTTGTAATTAAATGTTTAATTATA
TAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations