Transcript

tmprss5-202

ID
ZDB-TSCRIPT-131113-4346
Name
tmprss5-202
Previous Names
  • tmprss5-001
  • ch211-247l8.7-001
  • si:ch211-247l8.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057176 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057176|OTTDARG00000039860|ZDB-GENE-131121-184 tmprss5|OTTDARP00000044834 CH211-247L8.7-001 LG_ CR388163.10 Danio rerio protein_coding NOVEL, 2507 bp
TAAATAAATGGAACTTCCAGTTTAAAATAGGTCTCCAATA
GGCCTTCAGTTCACTACAGATTATTTCTTGATGTTAAAAC
TCAGTTGTAAGTTTAATATAGATGGATAAATATTTTGTAC
GTGACTGTCAAAAGCTGTAAGTATACTGACTTTCTCTACT
GAGTATGTATAATCTTTTAGTCTATTGTTAACAAATAAAG
ACAACCTGCAACACATAGAAACTTTTTTTCTGGTAATCAC
AAAAGCTCTTCATGATTCTGTTGTTATGCTTAAATGAGAC
TTGTCAGCATTCCACAGGTCAACTTTGTTTCCCAAAAGTT
GTGAACTGTCAGGTTCAGAGCTCTACGGCTCAGCGGATCC
TCCTCTTGGGCAGGTGAAGGTGGGGCTACACAGTCTGTAT
CCTATCAGTGACTGAGCGATTTCTTTGGAGATGTTTGGCT
CTACAGAGGGCAGTTTAGGCAGCCATGACAGGCCCCATGA
CCCCCTTGGTAAAACAACGGGTTCATTCTTTGCTCCGCTG
CTGACCTCATTGTCTCTTTGTGAAGTGAAAATCCAGCGCT
GCATTCAGCTCAATGGTCTGACAGCTGCTGGTGTGGAGCA
TCTCTGCTGTGATGGAGGTAAGTTGATGAGAGAGTCCAGC
AGCTGCTCTCAGGAAATCCCGAATCCCAACAACGAAAGCA
TGAGTCTCAGTAGAGATGCGGTGGCAGTGATTGAGAACCC
TGTAGTGGTCAGACAGTCTTTTCATCCAGAGAGTCTGCAG
GTGGACATGCTCGAGTCAGACCAGAATAACCACAGGTGCC
TCAGAGAGCTGCAGTTTCTCCATCCTGTGTCTGGCAAAGT
GTCATCTCGTAAACTAGTGAGAGTGTTTGCAGCTCTGTGT
GTGCTGTGTCTGCTGGGAGGTGTTGTGGTTGGAGTTTGGT
TCATAGTGAAATTTCTCTTAAAGCCAAACTTATCTCAGAG
CCCTGCGAGCCTGGGAGACACTAAGGACACGTCCTTCTGC
AATGTGACCGAGGACATCTCTGTGACAGATCCCAGGAAAG
TGTTTTACAGGATCAGTGCTGAGAACTCACTTCTGGAGAT
CCAGCTGGAGAAGCTGCAGACGTGGCTGCCTGTTTGTTTC
GAGAGGTGGAACTCGTCTCTGGGAACACTCGTATGTCGAC
AGCTGGGCTATCTGAGATTATCAAAGCACAAGGGAGTGAA
TCTGACTGATATCGGGCCGAATTATACAGATGGATTTGTC
CAAATCACCTCAGAATACCAAAGCAATTTGGAGAGCTTAT
GGCGCTTCAGGGGAAGCTGTAGTACAGGAAAGGTTATAGC
ACTAAAATGTTTTGAGTGCGGCACCAGAGCAAAGTTACCC
AGGATCATTGGAGGAGTGGAAGCTGCTCTGGGCCGATGGC
CATGGCAAGTGAGTCTCTACTACAATAACCGTCACATCTG
TGGAGGATCCATTATCACCAACCAGTGGATAGTTACAGCT
GCTCATTGTGTGCACAATTACAGGCTACCTCAGGTGCCCA
GCTGGGTGGTTTATGCAGGTATCATAACCAGCAATTTAGC
TAAACTTGCTCAATACCAAGGCTTTGCTGTGGAGAGAATC
ATCTACAACAAGAATTACAACCACCGGACACACGACAATG
ATATCGCTTTGGTGAAATTAAAAACTCCACTGAATTTTTC
AGACACTATCAGACCTGTATGTCTACCGCAGTATGACCAT
GATCTACCAGGAGGAACCCAGTGCTGGATCTCTGGTTGGG
GATATACACAACCGGATGATGTTCTTATACCAGAAGTTCT
CAAAGAGGCACCCGTACCTTTAATAAGCACAAAGAAATGC
AATAGCTCTTGCATGTACAATGGAGAGATCACCTCTCGAA
TGCTCTGCGCAGGATACTCTGAAGGAAAAGTAGACGCATG
TCAGGGGGACAGTGGTGGTCCTCTGGTTTGCCAGGATGAA
AATGTCTGGAGGCTGGTTGGAGTTGTAAGCTGGGGAACAG
GCTGTGCTGAGCCAAACCATCCAGGAGTTTATAGCAAAGT
GGCTGAGTTTTTAGGGTGGATATATGACATTATAGAGAGC
TACTAAAGGCTGACGTTTGAAAGTAGAAGAGAAGAACGTC
CTGACCCTTTTTTTTAAATAATGTTGCCTTTTATATTATT
TATTATATTTTATTACGCAAAGCCTCAGTATTTACAACAA
TGTAAAGATTGTTTGTTATTATTTGTTTGGTGTTGTGTTA
CTCAAGATAATTGTGGTTTTACAATAAATGTTTGACATTT
ACAAAAGGGGACAATGTGATCTGTTCTGTTCTCTTTTTGA
ATTGCTTAATCTTAAAAGCTTATGTTAGTTCAGGTGAAAA
TGGTAAAGTATTTATGTGTTTATCTGTGTAACAGTTGTTA
CAATATTTATATTTGACCATTTCTGGAAAGACTAATCAAG
TGCATGGCATTAACACGAATCTATGATGTTTCACGATCGA
TTTAATCCTTCAACTACCCCACCAAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations