Transcript

tmprss5-002

ID
ZDB-TSCRIPT-131113-1152
Name
tmprss5-002
Previous Names
  • ch211-247l8.7-002
  • si:ch211-247l8.7-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057177 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057177|OTTDARG00000039860|ZDB-GENE-131121-184 tmprss5|no_translation CH211-247L8.7-002 LG_ CR388163.10 Danio rerio protein_coding NOVEL, 736 bp
TATAGAACATACTTTTCTAACAGCCGAGTAGTACGTTTAA
ATTCAAATGCAGTACCTACTGAGTAGTAGGCGGTTTCGGA
CGCAGCCAAAGTCTTCTACTTGGTGTACAGTATGGCCTTA
GGGGAAAGTAAAAGCAAATTGTCAATTTTAGGTAAACTCT
CTTTACAAAAGCCCTGTTTATGTGAAATTGAAGGCCATAG
ACACTCACACCCTGCCTTTTTCTTACTACTCCAGGGGAAG
CTGTAGTACAGGAAAGGTTATAGCACTAAAATGTTTTGAG
TGCGGCACCAGAGCAAAGTTACCCAGGATCATTGGAGGAG
TGGAAGCTGCTCTGGGCCGATGGCCATGGCAAGTGAGTCT
CTACTACAATAACCGTCACATCTGTGGAGGATCCATTATC
ACCAACCAGTGGATAGTTACAGCTGCTCATTGTGTGCACA
ATTACAGGCTACCTCAGGTGCCCAGCTGGGTGGTTTATGC
AGGTATCATAACCAGCAATTTAGCTAAACTTGCTCAATAC
CAAGGCTTTGCTGTGGAGAGAATCATCTACAACAAGAATT
ACAACCACCGGACACACGACAATGATATCGCTTTGGTGAA
ATTAAAAACTCCACTGAATTTTTCAGACACTATCAGACCT
GTATGTCTACCGCAGTATGACCATGATCTACCAGGAGGAA
CCCAGTGCTGGATCTCTGGTTGGGGATATACACAACCGGA
TGATGGTAATGTTCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations