ZFIN ID: ZDB-TSCRIPT-131113-4266
Transcript Name: zgc:171901-202
Previous Names: ch211-210b2.5-002, zgc:171901-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056900 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056900|OTTDARG00000039664|ZDB-GENE-080220-13 zgc:171901|OTTDARP00000044637 CH211-210B2.5-002 LG_ BX248582.4 Danio rerio protein_coding PUTATIVE, 810 bp
GATTTTAGACAGGGGACTTTTATGTCGTTTCGTCGGTGAC
GTCATCAGTCAGCTCCGCGCTCCTGTTTGTTCTGAACAGG
CTCGACCAAGGGGCCTCCACTGGCTGCCTGTCCAATTCAG
AATTGATCTTCAGTGCTTTCACTGGTATATAAATCCCTTC
ATAATCCAGTCCCAACCCATCTTTCGGAGCTGTTGCACTT
TCAGATCAAGTGATTAAATCTTCTTGTAGCTCCTCAGTCC
AGACTGAAACACAGATGGGACAGAGCTTTCTCTGTGAGAA
CAGAACAGCAGATTATTATAAAGATGGCGTTTATTAAAGA
GGAGAGTGAAGATGTGGAGATTGAAGAAACATTCACAGTC
AAACATGAAGAGACTGAAGAAGCTTTCAGAGTCAAACATG
AAGATCCTGAGGAACAAACAGACCTGATGCTTCTGAAAGA
GGAAAATCAGGACCTGAAAGATGTGCAAGAGGAGGATCAG
CCTGAAGAACAACTTAATCTCAAAACTCGGACAACAAATA
AGTCTTACTTGCAAAAAAGTGTCCCGGAGACTAATTCCAG
TACCTGCCAGCAGTGTGGAAAGAGTTTCAGTGGGAAGCGA
AACCTTGAGGTGCACATGAGGATTCACACTGGAGAGAAGC
CGTTCACCTGCCAACACTGTGGGAAGAGCTTCACTCAAAA
GGGGAACCTTAAAAGCCACATGATAATCCACAGCGGAGAG
AAGCCTTACGCCTGCCAAATCTGTGGGAAGAAGTTTGCTC
AAAAACGAAACCGCGCCGACCACATGAGACTGCACACCGG
AGAGAAGTCC

zgc:171901 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:171901-201 (1)    Ensembl 2016
zgc:171901-202 810
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:171901-202 Contained in:
[BAC] CH211-210B2 (1)

Genome Resources: Vega_Trans:OTTDART00000056900 (1),  Ensembl_Trans:ENSDART00000156148 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DT069832 (1) 794 nt
CITATIONS (2)