ZFIN ID: ZDB-TSCRIPT-131113-2670
Transcript Name: zgc:171901-201
Previous Names: ch211-210b2.5-001, zgc:171901-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056899 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056899|OTTDARG00000039664|ZDB-GENE-080220-13 zgc:171901|OTTDARP00000044636 CH211-210B2.5-001 LG_ BX248582.4 Danio rerio protein_coding PUTATIVE, 2016 bp
GATTTTAGACAGGGGACTTTTATGTCGTTTCGTCGGTGAC
GTCATCAGTCAGCTCCGCGCTCCTGTTTGTTCTGAACAGG
CTCGACCAAGAGAACAGAACAGCAGATTATTATAAAGATG
GCGTTTATTAAAGAGGAGAGTGAAGATGTGGAGATTGAAG
AAACATTCACAGTCAAACATGAAGAGACTGAAGAAGCTTT
CAGAGTCAAACATGAAGATCCTGAGGAACAAACAGACCTG
ATGCTTCTGAAAGAGGAAAATCAGGACCTGAAAGATGTGC
AAGAGGAGGATCAGCCTGAAGAACAACTTAATCTCAAAAC
TCGGACAACAAATAAGTCTTACTTGCAAAAAAGTGTCCCG
GAGACTAATTCCAGTACCTGCCAGCAGTGTGGAAAGAGTT
TCAGTGGGAAGCGAAACCTTGAGGTGCACATGAGGATTCA
CACTGGAGAGAAGCCGTTCACCTGCCAACACTGTGGGAAG
AGCTTCACTCAAAAGGGGAACCTTAAAAGCCACATGATAA
TCCACAGCGGAGAGAAGCCTTACGCCTGCCAAATCTGTGG
GAAGAAGTTTGCTCAAAAACGAAACCGCGCCGACCACATG
AGACTGCACACCGGAGAGAAGTCCTTCACCTGCAACCTGT
GTGGAAAGAGCTTCACTCAGAAAGGCAATCTTAAAAGCCA
CTTGATCATTCACAGCGGAGAGAAGCCTTACAGCTGCCAA
CAGTGCCAAAGCACCTTCACTCAAAAGGTGCACCTTGAAC
AACACATGAAAGTCCACAGCGGAGAGAAGCCGTTCACATG
CGATCAGTGTGGAAAGAGCTTCACGCTCAAAGACTCTCTC
GGCTCCCACATGAGAGCTCACACAGGAGAAAGCCAGTTTA
TCTGTCATCAGTGCGGGAAAAGCTTCAATCACAAAAAAAG
CTTCAATATTCACCTGAGAGTTCACACCGGAGAGGAGCCG
TACACGTGCTGTTGGTGTGGACGGAGTTTCAGATATAAAG
CATCCCTCGATGTCCACATTAGAGTTCACACAGGGGAAAA
CCCTCATACCTGCCGACTCTGCGGGAAGAGCTTCACACAG
AAGGGCTCTCTTAAGGCACACATGATCATTCACACTGGAG
AGAAGCCGTTCACATGTGTTCAGTGCGGAAAGAGCTTTAG
ACGAAAACTAACCTTGAACGAACACGTGAAGATTCACATT
GAGAGTGAACTATTAGATCAATGTAATGCAGCTACATCAA
CGTGTAAAGATTCACTAACATGAAACACTTGAAGATACTA
AAGTAACTGGAGAGATGTTTGCCAGCACTACCTGCAAGAT
TAGCGCTTCCTTGATTGCTGCAGTCTTGAAGATTTGTGCC
CCAACCCTACCTAAACACACTTGAACAAGCTAATCAAGGA
CTTAGTGTTAAACTGTGGCAACACGGCACCTCATCAGTGT
GTAAAGATTCACCTACAAGAAACACTTGAAGACACTGTGA
AGTACCTGAAAACATGTTTGCCAGCACTACCTGCAAGCTG
AGCGCTTCCTGGATCGTTGCAGTTCTGAAGATTTGTGCCT
CAACCCTATTTAAACACACTTGAACGAGCTAATCAAGGTC
CATCGAGGTGTCAAACTGCACTTTTCGGCTCATTGACTTT
AATTCATAAGCATGCCAATTGCAGCAGACCAAAAACGCAA
GTTCTGACAACAAGTTTTTGATGTCAGTGTATTCGAAAGT
TCAAGCTTGGTGAACTCTGACCTGCAACATCACATCACGT
GATTGTGTGAGACCGATAGAAGAGCAAAGCTTGACCTCTC
TGTACAGAAAATTGAAATATGGAGCAGTTGCTCGATTTAT
TAATGTCGGATAATCTTTAATCCTGCCCTTTTTCGCAGCG
CATTATTCAGTGTGTCTGTCCACGTTTTGCACTTGTTTAA
ATTCTATTTAATGTAGCACACATAATTGCCGTCTTTTTGT
GGCTATCGTGACCTGACGCTTGACACTGTGAACATCAGTA
AAGATCGTCAATTGTT

zgc:171901 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA zgc:171901-201 2016
zgc:171901-202 (1)    Ensembl 810
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:171901-201 Contained in:
[BAC] CH211-210B2 (1)

Genome Resources: Vega_Trans:OTTDART00000056899 (1),  Ensembl_Trans:ENSDART00000115375 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC154476 (1) 1983 nt
GenBank:BC171385 (1) 1374 nt
GenBank:CO960350 (1) 821 nt
GenBank:CO920695 (1) 725 nt
GenBank:CT639550 (1) 436 nt
CITATIONS (2)