ZFIN ID: ZDB-TSCRIPT-131113-4241
Transcript Name: snx20-202
Previous Name: snx20-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056783 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056783|OTTDARG00000039574|ZDB-GENE-100806-1 snx20|OTTDARP00000044542 snx20-001 LG_ CU469312.7 Danio rerio protein_coding NOVEL, 1213 bp
AGCAGATTATCCGATGTCTGTGTGCACAGAGATCTAATTT
TGCCCAACTTCCTGAGGAAGTGCAGCACTTTACCTTTCAC
CGCATGGAACTAATGTAATGTATTTCCTTACAGAGAGCTA
AAATTATCAGATCTTCATGGAGGAAGAGGAAAAACCACCC
AACATCACTGCTAATCACACGGTTTCATCAGCTCCTGAGC
ATTTATCACCCCACCAGGAAACGTTACAGGGTAATGGAGA
GTCTGCAGAGGATGATCTGTGTTTTGGCGCCTCCTGTCTG
ACCACGGCAGAACTGCAGCAGCACTGGAGAGCCGTCAAGC
AGGAGTTCAGGAGCGTTAAACTGCTGTTCGACATCCCCAG
CGCCAGAATCATCTCACAAACCATCTCCAAACATGTGGTG
TACCAGGTTGTGGTTATTCGCTCGGGTAGTTACGACTGTG
AGCGCGTGGCTATCGAGCGCCGCTATTCAGACTTCCTCCA
CCTCCATCAGGAGCTCCTGTCCGACTTCAGCGAGGAACTT
GAGGACGTTGTGTTTCCCAAAAAGAAGATGACCCGAAACT
TCTCTGAGGAGATCATCGCTGAGCGTCGCGTAGCTCTGAG
AGACTATCTGACCCAGCTCTACTCCCTCCGCTTTGTCAGG
AAATCCCAAGCGTTTCAATCCTTCTTCACTCATCAGGAAC
TGAAATCTGCATATGATCTCCTGAGGGGGGGACGCTTCTC
CCGGGCCCTCGAGGGCCTCCAGAAGGTGTTGGTGCTTCAG
GAGAAACTCTCCTCTCATGATGCTACGTTAGTGATTCCGA
CATTGTGCGCCATATTGGTTTGCCAAAGGGATCTAGAGGA
CTTCGAGGCTGCCTTCGAAACTGGCAGAAAAGCTTTGCCC
ACAGTGAGGAGATATGAGCTGCGAAAGCATCACGGGCCCC
TGCTGGAGGCTCTGGTTGATTTGGGGTTCAGTCTGGAGCT
GCCGGTGGCTCAGCTACAGGACGAGCTGATCAGAGTTAAT
GACTCTCCATGTGGGAAAGAGACACAGATGTCTCTTAAAG
AACTGGTGGTGCAAGAGTTTGTATGATTTTTTTTGTGTGA
CTAAAATGATTATGAGGCGAGTTTCACTGCATTTATTTAA
TTATTTTGTTGTCAAAATGTACACAAATCTAAATTCTTTA
ATAACTTACCTCGAGAACCATTGATTTCTTGAATTTATGT
AAAGGAAACACTG

snx20 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript snx20-204 (1)    Ensembl 703
mRNA snx20-202 1213
ncRNA snx20-002 (1)    Ensembl 854
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
snx20-202 Contained in:
[BAC] CH73-364F24 (1)

Genome Resources: Vega_Trans:OTTDART00000056783 (1),  Ensembl_Trans:ENSDART00000153612 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CO928266 (1) 838 nt
GenBank:BM316147 (1) 515 nt
GenBank:AL916947 (1) 499 nt
CITATIONS (2)