ZFIN ID: ZDB-TSCRIPT-131113-1048
Transcript Name: snx20-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056784 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056784|OTTDARG00000039574|ZDB-GENE-100806-1 snx20|no_translation snx20-002 LG_ CU469312.7 Danio rerio protein_coding NOVEL, 854 bp
CTTCAGTCAGCATGAAAAACAGAAGCAGGAACAGTAAACA
TGACCTCTTATAGAGACACAAGTGAACTTACACTTTCAAC
TTCAGCAGATTATCCGATGTCTGTGTGCACAGATTTCCTT
ACAGAGAGCTAAAATTATCAGATCTTCATGGAGGAAGAGG
AAAAACCACCCAACATCACTGCTAATCACACGGTTTCATC
AGCTCCTGAGCATTTATCACCCCACCAGGAAACGTTACAG
GGTAATGGAGAGTGTAAGTTGATTCTGTATGATCATGAGA
TCAGATTGTGACGTGATGTCCTCTGGGTGTGTGTTTAACG
CATCAGACCTGTGTTGATGTGTGTGTACCCACCGGCAGCT
GCAGAGGATGATCTGTGTTTTGGCGCCTCCTGTCTGACCA
CGGCAGAACTGCAGCAGCACTGGAGAGCCGTCAAGCAGGA
GTTCAGGAGCGTTAAACTGCTGTTCGACATCCCCAGCGCC
AGAATCATCTCACAAACCATCTCCAAACATGTGGTGTACC
AGGTTGTGGTTATTCGCTCGGGTAGTTACGACTGTGAGCG
CGTGGCTATCGAGCGCCGCTATTCAGACTTCCTCCACCTC
CATCAGGAGCTCCTGTCCGACTTCAGCGAGGAACTTGAGG
ACGTTGTGTTTCCCAAAAAGAAGATGACCCGAAACTTCTC
TGAGGAGATCATCGCTGAGCGTCGCGTAGCTCTGAGAGAC
TATCTGACCCAGCTCTACTCCCTCCGCTTTGTCAGGAAAT
CCCAAGCGTTTCAATCCTTCTTCACTCATCAGGAACTGAA
ATCTGCATATGATCTCCTGAGGGGGGGACGCTTCTCCCGG
GCCCTCGAGGGCCT

snx20 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript snx20-204 (1)    Ensembl 703
mRNA snx20-202 (1)    Ensembl 1213
ncRNA snx20-002 854
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
snx20-002 Contained in:
[BAC] CH73-364F24 (1)

Genome Resources: Vega_Trans:OTTDART00000056784 (1),  Ensembl_Trans:ENSDART00000153919 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CO932520 (1) 861 nt
CITATIONS (2)