Transcript

ca12-201

ID
ZDB-TSCRIPT-131113-4196
Name
ca12-201
Previous Names
  • ca12-001
  • dkeyp-73b11.11-001
  • si:dkeyp-73b11.11-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000056627 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056627|OTTDARG00000039446|ZDB-GENE-080815-4 ca12|OTTDARP00000044411 DKEYP-73B11.11-001 LG_ CR391977.5 Danio rerio protein_coding NOVEL, 2072 bp
CAATTTTAATGCTGTTTAATTTAATGCCAACAAATGTTTA
ATTTAGTGCATCAGTCAGAGAATGATGCTTTCCCTGACTT
TTTGTTTCAGGACTTGATGGAGAACACGACTGGCCCACCA
ACTATCCGTTTTGTGGAGGAGCATTCCAGTCCCCAATCGA
TTTCCAGACACATTTGCTGAGATATGATCCAAACTTGCCA
CCCATCCAGGTCCAGAACTATAACCTGTCAACCAGTGAGC
AGCTCACTCTTGGCAACAATGGGCACTCTGTGCAGTTGTC
ATTGCCATCTCACATGTACATATCCAGCCTTCCTCACAGA
TATTCAGCAGCTCAGCTCCACTTCCACTGGGGCTCTTCTA
ACCTGCTGACTGGATCAGAACACACTGTTAATGGCAAGCA
GTTTGCTGGAGAGATGCATGTAGTACACTTCAATTCTGAC
AAATACCCTAATGTCTCCATGGCTGTGGACAAACATGATG
GACTGGCTGTGCTGGGAGTTTTTATTGAGATTGGAGAGGC
CAACCCAGCTTTTGACAAACTTTTCAGATTCATCAGTGGA
GTAAAGTACAGAGATCAGAAAATACAAGTACCAGCATTTA
ACATCCGTGCACTGCTACCAGACCGATTGGATCAGTATTA
CCGTTACGATGGTTCTCTGACCACACCACCCTGCTATCCT
AGTGTGCTATGGACAGTGTTCAGAAAACCAGTCACAATTT
CAAGAAAACAGTTTTTGGCATTGGCCACAGCTCTATATGC
CTCCTTTGCCCAAGACTCTCCTTCCATGCCACTTCATGAA
AATTACCGGAAGTCACAACTCCCTGATAACAGAGTGGTAC
TAGTTTCCTTCAGAGAAGAGTTGCTGCACCACAACATTTG
TTTATCAGGAGACTTTACATGGATGAGCTGGGGTATCATA
GCCTCAATAACAGCAGCATCCATGCTAGGACTGCTAATGA
TTATTACGCTGGTTTGGTGTATTTTGAGAAAAAGATCTTA
CACAGAAGAGCAGGAGGAGAAAAACAATGGGTGCAAGCTC
TCTGAGAAAGAAGAACACATCTCTTAAGTATAACCTTTCA
ACAACTGATGAAACCTGAACAAATTAAAACATGAAATTTC
TGTGCCAGATGATTTTTTTTATTCCTCCATGTATTTTTAT
CCTTGGCACATGATCCTGAGTACAGAGGAACTATCTGGTT
GCGTGCAGCATTTATTTCAGAAATGTTAAAAGATTGACTA
TTTGAATACCAAGAGGTCTTCAACCACAATATATATATAA
GACCCAAAATCCTAAGATGACACAAGAGGAGAACAAAAAT
ATGTTGTTGCATGTAACCCACCAATCAACATCAAACCTGG
TGCTTTGAGAAGCAGGAGCCATCATCTGCCAGGGTGGCCT
TCTTTTGATGTCTACCGGCATGTGACATCTTTCTATAGTG
CCAAGCAGACGTGGTGGGAAAACACAGCTTCTGCTTAAGG
CAACGAGGACGTTTTGGTTCAGCATGGATATGCGGTGGCC
TGAGATGGGTAGTTATGATGTCCCCACCCTATATTTACTA
TTGTGCTGTTTGACCGATTAGAGTAATGAAAGGGTATATG
CAGAGCCGCGCTCTCAGTTCCCACTGTGCATGCCACAGAA
CTGGACTATTGTTTCTCAGTTTACATGTAGGTTGACCTTT
GACCTGTCATTGCTGAAGCAATCATGAGACTAAACGCCCA
TGCAAACCCAGTAACCCATACAAATGTGAATTACAAGAGT
GCTCAGACTTTCCCAAATACTTACAGTGATTACCTCACTG
AAAACTACATGTTGAAGATTCACAATTTTTGAAGATGGAT
TTTATGGAAGTATGAAACAATAATAATGATTAGAACTGGA
AACTCTGAATGATGTGAAGCTAATAATATCCATATTTTCA
TGTTGTGAGACACTGCATAAAACCATTTTCCATGTTGTTT
CAGACTTGTTAAATTTGGTTAACTATGGTCTGTTTGCGGC
GAGGCAGAGGCGCAGCAAGAAGGTCGCTGGGATGCTGGTT
CGAACCTCGGCTCAGTTGGTGTTTCTGTGTGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations