Transcript

usp3-002

ID
ZDB-TSCRIPT-131113-4194
Name
usp3-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056621 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056621|OTTDARG00000039443|ZDB-GENE-030131-5142 usp3|no_translation usp3-002 LG_ CR391977.5 Danio rerio protein_coding KNOWN, 630 bp
AGGGAACTTGGTAGGTTTTGAAACAGCCTGAGTCTGTGCG
TGCATGTCTGCTATTTTAACCCATAACAACACTGTTTCAT
TTAACAGACCAGCAATATAGCTCACACATTTAAACGTAAA
AGTAATCACCCATTTGAAAACGTATTTTGTGCCTCTCAAC
TTGCATTTTAAAAATTTAATAATTACAGTAATCATTTAAA
CGTAGACTTAGCTAGTGTAGCTAGCTCACAGATTCATGGA
GTGTCCTCACCTCAACTCCAGTGTCTGCATGACAGTGGAT
CTCACCCGGTTCCCCAACGGTTCCCCTTCTTCATGGTGCT
GTTCCGTTTGCCGGTCAAACAAAAGCCCTTGGGTTTGCCT
GACGTGTATGAACGTGCATTGTGGACGGTGAGTACTTAAA
TGTATAGATTATTTTTTCAACTTAGTCCTTTTATTAATCA
AGGGTCTCCACAGTAGAATGAACTGCCAACTTATCCAGCA
TATGTTTTGCGCTGCGTATACTCTTCCAGCTGCAACCTAT
GACTGGGAAACCCATACACACTTATTCTCACACAAACACC
ATGGCCAGATTAAGCTTTCCTAATTTACCTATAATTCACC
TTTCCTAATTCACTTATAATTTATTTAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations