Transcript

usp3-201

ID
ZDB-TSCRIPT-131113-2598
Name
usp3-201
Previous Names
  • usp3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000056620 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056620|OTTDARG00000039443|ZDB-GENE-030131-5142 usp3|OTTDARP00000044409 usp3-001 LG_ CR391977.5 Danio rerio protein_coding KNOWN, 2582 bp
AACGTTGGTCCTTCCCGCCGTAAAACCGAAGAAGAAGTTC
TCTTTTTAGACAGCATTTTTGATGTATAGTTAGGGAACTT
GGTAGGTTTTGAAACAGCCTGAGTCTGTGCGTGCATGTCT
GCTATTTTAACCCATAACAACACTGTTTCATTTAACAGAC
CAGCAATATAGCTCACACATTTAAACGTAAAAGTAATCAC
CCATTTGAAAACGTATTTTGTGCCTCTCAACTTGCATTTT
AAAAATTTAATAATTACAGTAATCATTTAAACGTAGACTT
AGCTAGTGTAGCTAGCTCACAGATTCATGGAGTGTCCTCA
CCTCAACTCCAGTGTCTGCATGACAGTGGATCTCACCCGG
TTCCCCAACGGTTCCCCTTCTTCATGGTGCTGTTCCGTTT
GCCGGTCAAACAAAAGCCCTTGGGTTTGCCTGACGTGTAT
GAACGTGCATTGTGGACGGTATGTTAATGGCCATGCCAAA
AAGCATTTTGAAGAGATTGAAGCTCCAGGTTGCAGCCAAA
GGAAGCCAGACAGAGAAAAGTTGAGGGAGAAGGGTCAACA
GCACTCTGTGTGTATGGACTGTAACAGTTATAGCACATTC
TGTTATAAATGCGACGAATTTGTGGTGAATGACACAAAAC
TTGGGCATGTGCAGAGGGTCAGAGAACATCTACAGAGTTT
GGAGAACTCTGTGTGTAATACCGACAGACAGAGAAAGAGA
AAAATGTCTGAAAGTTTTTCTCCTGACAGCAAGATGAAGC
AAGACAGTGAGGGCGCTCTAGTGCAATGTGCCACAGGCCT
TCGCAATCTGGGCAACACCTGCTTTATGAATGCCATTCTC
CAGTCTCTGAGTAATATCCAAGTTTTCAGCTGTTATTTCA
AGGAGTTGCCTTCAGTGGCCTTACGAAGTGGGAAAACGGC
AGGAAGGAGAATGTACCACACCAGAAGTCAGGGGGACAGC
AGTGTATCTCTGGTTGAAGAGTTCAGAAAAACCCTGTGTT
CGCTTTGGCAAGGAAGTCAGACTGCCTTCAGCCCAGATGC
TCTCTTTTATGTCATCTGGAAAATAATGCCAAGTTTCAGG
GGCTACCAACAACAGGATGCACATGAGTTCTTGCGTTACC
TGCTGGACCATCTCCACCGAGAGATGCAGGGAAACAAGAA
TGGGTCACCCAGTCCTCCTGTGACCTCCGATGAACCCAAT
CATGCCTCCGAGAGCAAATGCTTCATAAATGGGACATCCA
CTATTGTTACATCTGTGTTTGGTGGCGTTCTACAGAATGA
GGTGTATTGCTTGATATGCGGCACGGAGTCTCGGAAATTT
GATCCATTCTTAGATCTTTCACTCGACATTCCCAATCAGT
TCAGAATCAAAACCACAAAGGACCAAGAACCGGGGCCAAC
GTGCACTTTGAGTGATTGTCTTCGTAGTTTCACAGACCTT
GAGGAGCTCGATGAAACAGAGCTATACATGTGTCATAAGT
GTAAAAAGCGACAGAAGTCCACCAAGAAATTCTGGATCCA
GAAACTGCCCAAGGTGCTTTGTCTACATTTGAAGAGGTTC
CACTGGACAGCATTTCTGAGGAATAAGGTTGACACCTATG
TAGAGTTTCCCATGTGTGGCCTTGACATGAAAAGCTACTT
GTTAGAGCCTGAAAACAGCTTGCCTGAGAGATGTCTGTAT
GATCTTGCTGCTGTTGTGGTGCATCATGGGTCTGGAATCG
GCTCAGGACATTACACAGCATATGGGCGCCACGAGGGCCA
ATGGTACCATTTCAATGACAGCACGGTCACTCTGGTCAGT
GAGGAGGCTGTGCTGAAAGCCAAGGCTTACATTCTCTTTT
ATACTGAACACAGTGATCGGGAGAGTCAGTCCAAGCTTTA
AGACTTTTTTTCAGATCAGCTCAGTCAGTTGTTGTCAGTT
GTTGGATCTTCGTATGTATCATCTGTCTAATGTTTTATGC
TATCCAGTTATGATTTCTACGTTACAAAACCTCAGTAAAA
ACCGAATTGCTGCTTATATTTTAACTTGATGACTTTTTCA
TTAAACAGACACAATTTTTTTTTTTCACATAATGCCACCA
GTTTAAAAAATTGTGTAAAAAGATTCCAAAAGCTATTCCT
CAAGATACTGTTTTTTTTGTGATGAAAAAAGACTTAAATT
GACTTTGAATATAAAATGTCTTAGTTGATTTTTAAAAAAT
ATTATTCCATCAGCTAAAAAAATGCTGTCAAATTTCTATC
AGACACTGATGTCTCCTTATGCCAACATACTGCTTGCTGC
TCCTGAAAAATGTATTTCTGTTCAGCTCAGAAATTCGTTA
TTGTCCTCTAAGAGTGCTGATGATCAAGTTTGATGTGGAG
GTCTTTCTGAACCAAAACTTGAAAATTTTCATTTTACTTG
ACAAACAAGTAGTTATTGGTATCGCAAAGCAGTAGTTGAC
TCAGTCACAGCTTTCACATCTATATTGTAAAAATCACTTC
TGAGAATGGTCCAGTAGCTCACATGTTTCTTGAAAATGTT
TGACCAACTGTACAGTTTGTATTCTTTTAGAATTAAAGGG
ATGCACACTGTGTAAAAGTTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations