Transcript

b4galnt4a-202

ID
ZDB-TSCRIPT-131113-4191
Name
b4galnt4a-202
Previous Names
  • b4galnt4a-002
  • dkey-96j22.1-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056611 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056611|OTTDARG00000039434|ZDB-GENE-100422-4 b4galnt4a|OTTDARP00000044401 DKEY-96J22.1-002 LG_none CT573392.14,BX649494.6,CT573396.12,CR854832.20 Danio rerio protein_coding NOVEL, 514 bp
AGTCAAGAATCAGGCTCGTTGGGTTCAGCAGTTCATTTCA
GACATGGAGTCCCTGCATAGCGAGACAAAGGACAACAATT
TCAACATCATCATTGTGGACTTCCAGAGTGAAGACATGGA
TGTGGAGCAGGCCCTCAGAGAAAGCACTGTTCCACGGTAC
ACTTATATACATGCTTGGTAACTTTGCCTCTCTTCTTGGC
TGTTAAAGCGATACTTGTGGATCCAAATATGAGCATGCCT
GAGGTCCAAGATTTCTCCACTGTGTCTATTATGGATTACC
CATGATAACCGCATATTATTCGCACGTAGACTGTAACTGC
GACTGTTCTTCCCGCTATTGTGACAACAATGTAACATTTA
TGAAAACCACGTGACTGTCTCTGTAGGTTACTGGGAGGTA
AACGGCTTTGGTTTGTTTGGGATCTACAAGTCAGATTTTG
ACAAGATTGGTGGAATGAACACAGAGGAGTTTAAGGACCG
ATGGGGCGGAGAAGACTGGGAACTGCTAGACAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations