header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-4191
Transcript Name: b4galnt4a-202
Previous Names: b4galnt4a-002, dkey-96j22.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056611 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056611|OTTDARG00000039434|ZDB-GENE-100422-4 b4galnt4a|OTTDARP00000044401 DKEY-96J22.1-002 LG_none CT573392.14,BX649494.6,CT573396.12,CR854832.20 Danio rerio protein_coding NOVEL, 514 bp
AGTCAAGAATCAGGCTCGTTGGGTTCAGCAGTTCATTTCA
GACATGGAGTCCCTGCATAGCGAGACAAAGGACAACAATT
TCAACATCATCATTGTGGACTTCCAGAGTGAAGACATGGA
TGTGGAGCAGGCCCTCAGAGAAAGCACTGTTCCACGGTAC
ACTTATATACATGCTTGGTAACTTTGCCTCTCTTCTTGGC
TGTTAAAGCGATACTTGTGGATCCAAATATGAGCATGCCT
GAGGTCCAAGATTTCTCCACTGTGTCTATTATGGATTACC
CATGATAACCGCATATTATTCGCACGTAGACTGTAACTGC
GACTGTTCTTCCCGCTATTGTGACAACAATGTAACATTTA
TGAAAACCACGTGACTGTCTCTGTAGGTTACTGGGAGGTA
AACGGCTTTGGTTTGTTTGGGATCTACAAGTCAGATTTTG
ACAAGATTGGTGGAATGAACACAGAGGAGTTTAAGGACCG
ATGGGGCGGAGAAGACTGGGAACTGCTAGACAGG

b4galnt4a TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript b4galnt4a-202 514
mRNA b4galnt4a-201 (1)    Ensembl 6357
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
b4galnt4a-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000056611 (1),  Ensembl_Trans:ENSDART00000155559 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)