ZFIN ID: ZDB-TSCRIPT-131113-2595
Transcript Name: b4galnt4a-201
Previous Names: b4galnt4a-001, dkey-96j22.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056610 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056610|OTTDARG00000039434|ZDB-GENE-100422-4 b4galnt4a|OTTDARP00000044400 DKEY-96J22.1-001 LG_none CT573392.14,BX649494.6,CT573396.12,CR854832.20 Danio rerio protein_coding NOVEL, 6357 bp
AGGATTCGCAACGTCGCTCCCTGGAAGCGTCATGGATGCT
CAGTTGAACGCGGGGATCGAGAGTCGAGCACATCGCAGGA
CTGGAAGCGGAGCTTGTGGGATTTATTGCTAAACAGTCTC
TCTGACTAAAGGCGTGACAACATCAGACTGGATCCGCGTG
CAGACTGATCCATCGCATCATCGCCGAAACAAAACGTTTG
TTTTGCGGAGCGCACTAGTGGAATCAAAATGTCAGATGCA
GCTAGCGGTATTGGAGCTTACAGACGCCAATAGAGCATGT
TATTGTTTATATGCTTATGATTTTCTGCTTACTGGGGATA
GAGCGGTTGAAGACGTGCGTTTTGTCTACATTTCCGAAAG
CAAATAAGTTGCGCGTGCACTTATGGATGGATAGCAGGTG
CACGAACGGCTCACCTATAAATGTGATTCTTCACTCGCGG
CTGTTCTGATTTCACGAGCCCGGGAAAATAATATCCGAGG
ATAAAACAGCATGTTTTTCCATTATAGCAGTGCGATAAGA
CACCAGTCGTGTTATGTTTAAATTGTGTCAAATTCTAAAT
CAGTGCAGCCACTCGAAATGTTAATTTAATTAGATACAGT
AGCGTAAATCTAAAGAGTTTTATGTTTATTTTGTTTTCCG
TTTTACGTTACGACAGTAACTCATCCCTTTATGGTTACGG
CTATTTTAAAGTCTAAATTATTGTTATTTTGTATTCAAAG
TAATTCCAACGTGACGTATACCATGCTGTGATAAATTCAC
AACACTTTCTGACCACTTTGAAACTAATGGAGAAACTAAA
AGCAGAAATTATTTTAAACAAATATGTTAGCAGATTGTAC
AATGCATAATGCTATTCTATGAGTTGTTTTCTATCTAAAT
ATCGTGATTTCTTTAGCTAAGTGTACATCAGTTGTATAGT
TCTCATTGGTGATTTGGATACCCAAACAAACTCAAAAATG
CACTTAGTTCCTGATCCCAGGAAGTATGGGGTGTGCAGTT
TGATTGGGTTGTTTATAGTTAATTAAATGCAAAGTCAGTG
TTAAAAGAGACTGGTCATTTGAGCGAAAGCTTTAAATCCA
GAGGATGATCTTCTCTGGAGTGGCTGGACTGCTGTCAGAG
CGGCTTTCACACGATTAACAGCCCGCTGCTCTTTTCTTTG
CCTGTCCGCCCACACTAAAATCATTTACTGGACTATATGC
TTTAAAAACTAGTTTGAGGTAAAGAGGATCAAGAATTTTT
AACAGTGCAACAGTGGCATGTATTGTAAATCATACATAGC
TGTATGATGACTCTAAAACACTTATTTCAGCAAATTAGTG
CAAGTTTAGTTACTGAAACCTGTTAAGCTTGAGCGTTTTG
TCTTTAAAACAGATCAAATTGAGAATATAGATGCATCTTT
TTTGAAGAGTGCCAAACCAACTGAATTTACAAACTATAAA
CATGACTTTGAGATACCAGGAACGCTTATAAATTGTGAAC
AGCAGACAGTACAGCTTTTTGCATCAAGCATTTCTTTACG
CCGCTGATGCAAATATGACCTTGTGATATCAGGAATTCAG
ATGCAGCCGATACCGAAGCTGATGCTGCTGTTGGAAACAT
GACATTGTGACATCAGGAGTCTGCCTCTAAAGCACCAGAC
TTGAGGAGCAGCTGACACTCTCTTTTTTGCTGCTGCTGCT
GCTGATGATGCTGCAGCTGCGAAAATGCTGCGATTCCCTG
TGAAGAAAATACGAAAACAGTTCAAACTTCTGCTGCTGCT
GGTGCTGCTCACTTTTGCAGTATGGTTTACGTACCTGCAC
ATCAACCAGGGCAAATCCATTAAGCTCCATTTCAATTATG
GGAAAGATGGTGAGAGGCCGATGGAGGGAACTGACACCAG
CCATAAGAGAGACTCACGTTCATCAGACAAGTACCGCAAA
AGCGAAGATGCCAGCAACAGCCAGGAGGAGGATAACACAC
AGGAAGATGAGCCCAACGCCGGCACTGCTCACAACAAAGA
TCAAGCTGAAATTCGCAAGTTGCTTGCACAGAAGTACAAA
AAGTTGCCATGGAAACCAGAGTTTAAAGGTCAAGCGAACC
TCCACGTGTTTGAAGACTGGTGTGGCTCCTCAGTCGCTCA
GCTCAGGAAGAATCTTCATTTTCCTCTCTACCCCCATACG
AGAACTACTGTAAAGAAGTTGGCTGTGGCTCCAAAATGGA
AGAACTATGGCCTGAGAATATTTGGATACATTCTACCTTA
TAAGGATGGTGATTTTCAGTTTGCTGTTTCTTCTGATGAT
AACTCTGAGTTCTGGTTAAGTTCAGATGAAAGTCCTCTCA
ACGCCCGACTGCTGGCCTATGTGGGGAAGCTGGGATCTGA
GTGGACCGCTCCAGGAGAGTTTACCAAGTTCAGGTCCCAG
GCATCCAAGTCTGTGCATCTGATGGCCTCCAGACGATACT
ACTTTGAGATTCTCCACAAGCAGGACGATAAAGGTTCAGA
TCATGTGGAGGTTGGGTGGCGCCCTTTCCTGCCAGGACTC
AAATATGAGGTCATCGATTCTGCCTACATCTCCTTGTACA
CAGATGAGAGCAGTTTGAAGATGAACCATGTGGATCACAT
TCCGCAGACGCTGGCCAGCCACAGTCGTGTTCCTGCAGAG
ACCCACATCCACAGCCAACACGGCGCCGATATGCTGCAAC
CGGACCCCCGCGACACCTTTTTCAACATTCCCATGATTGA
CCCTGCTCATCTTGAAAATGTGCTGCCCGCCTGTCTCTAC
TCTCCAACATATGTTGTCAAAGACTTCCCTATTGCCCGCT
ATCAAGGACTACAATTTGTCTATCTTTCTTTTGTCTATCC
CAATGATTTTACCCGCCTTACTCACATGGAAAAAGAAAAT
AAGTGCTTCTACAGAGAGTCACCCATCTATCTGGAGAAGT
TTGGCTTCTATAAATATATGAAGATGGATGAAGAGGAAGA
TGACAGGCCGTTTTTCTTCCCTAATCCTGATGATTTTCTC
GAAGAAGAAGAGGGAGTGGATCCGGATGATGAAGCACAAG
TTGTTGGCACCCAGTCAGCAAAGAAAACCATCCAACCTAG
CCAGTCAACTCACACCTTAAGCCCTTCAGACAAACCTGTT
CCCACAATGCTGGACAGAAAAGAAGTAGAACCAGGGAACC
CAGCATTAAGAAGAGAGCAAAGGCGCTTTTTTGCCAGTGC
AAGGCAGCCAGTAGTGCCTGAAGCTCAAGAGATGGAAAAA
GACACTCCGGACCATCAAATTAATGTAGGGTCACCAAAAA
GTGAGAGTGTGGTGAGAGGTCGTTCTCTTGCTTGGGTTCA
AAGAGACCGTAGAGAGGGATGGTCGGAAGAACGTTCCCCC
AAAATAAGTAGAACAGCTTTGCTGTTTCCACCAAAATCCT
CATTGGTTGCCCTTAACAGTCGAGCTAAGCAAATCCTCAG
CAACCCAAACCCATCACCAGCCAACAACCATGCTCACGAC
AACAACCGCAACCCTGGAAACATCCATGCCAACAAAGAAC
ATAAGAAGGAAGACAACAAAATCTACGTCACAAGGCCTCG
ACCTGCTAGGGAGAAGCAAGGTCTTGTTTCGCGCCATCCC
AGAGAGGTCTTCCCTGGTGTTTTCCTCTATCAAAATGGCA
AAACAACAAAGTTAGTAAATCTCAGCGCCAAACCAAAACT
TGGTAAAGGACCTCTACGGGCATCGCAGCTATTCGCGCGA
TCTCCTTTGCAAGAATCCAAGGTGTTTCCAGCTAGCCCGA
ATTTCAGCAACCCAATACCCCCAAATAGAGCAGCAATCCC
AAGCCATTTCGAGCGAAGGATAAGGGGCGTCTGGGAGAAA
CACCAGCATCCTTTGAGGCCTGTCACAACCCTACGCCCCA
CTCCTCAGTCCTCTAACTCCTCTGAGAATGTGCCGCCAAC
CGAGTCGGTTCGTGTCACTTCCTATATGCACACCTCACAG
ATTACAGAGTCCCAACAGCAGCGGCCGGACACAGACCTGG
AGCCTGAGGAGGACGGAGGTTTATCAGAGTACAGCTATGA
GGACGTGGAACCTCGGCCTGGATGGGCAGAGGAGGCCATA
AATTGGCAGAGGACATTTTCTGTCAACAGCATGGATTTTG
AATCGTTGCGCTCCGACTGGAATGATCTCCGCTGCAATGT
GTCAGGAAACCTGCAGCTGTCTGAAAGTGAAGTGGTGGAC
GTGCTTGCACAGTACATGGAGAAACTTAACGAACGCAATG
GAGGGATCTACACTCTCCTTCGCATCATAAATGTTGAAAA
GCGCCGTGACTCTGCGCGGGGAAACCGCTACCTGGTTGAG
CTGGAGTTAATGGAGAGAGGCCGGAAGATAGTCCGCCTTT
CTGAGTACATCTACATGTTGTTGCACCGTGGACGGGCGGA
AGACAGTCTGGAAAATGTTGAAGGGGTAACAGCATCGTCC
CCCTCTTCTCCTGTTGCCAGCCCACCTGCTCAACCATCTC
ACACACCAACTCGTGGGGCCCGCGGCACCCCTCAGTGGGG
CACAGTGTATGCAAAACCTCTGCTATGCCAGCCAGTGATG
CTGAGGTGGAAAAAAGATGTCATGGTGCATTTTGTAGTGC
CAGTCAAGAATCAGGCTCGTTGGGTTCAGCAGTTCATTTC
AGACATGGAGTCCCTGCATAGCGAGACAAAGGACAACAAT
TTCAACATCATCATTGTGGACTTCCAGAGTGAAGACATGG
ATGTGGAGCAGGCCCTCAGAGAAAGCACTGTTCCACGATA
TGAGTATCTAAGGAGGGAAGGAAACTTTGAACGTTCTGCC
GGCTTACAGATTGGTGTGGATACCATAGAGGACAGTCACA
GTATCGTGTTTCTGTGTGACCTGCACATTCATTTCCCTCC
TAACATTCTGGAGAACATCAGGAAACACTGTGTTGAGGGC
AAACTGGCATTTGCACCTATAGTGATGAGACTAGGCTGTG
GGAGCTCACCGCTAGAGCCTGATGGTTACTGGGAGGTAAA
CGGCTTTGGTTTGTTTGGGATCTACAAGTCAGATTTTGAC
AAGATTGGTGGAATGAACACAGAGGAGTTTAAGGACCGAT
GGGGCGGAGAAGACTGGGAACTGCTAGACAGAGTTCTCCA
AAACGGTCTGGAGGTTGAGCGCTTAAGACTGAGAAACTTC
TTCCACTACTATCACTCCAAAAGAGGCATGTGGAACTCAC
AGTCTAGTAAGACTCCTAAATGACGAATAACTGGAGCTCA
CTGAGAGAGATGTCAAAAAGAAACTCAGCTCAAATAACAG
GACCTTGAAGGACCAAACCATTGTGTTCTCTGAGACCTCA
AGTAGGACATCTCATAAAGGAGGACCAGCTGCTGTCCAAA
CTCAAAACACTCAAAGAGACTGGCATTCATTGAGTGTATT
TGTACGTATCTCTGTCCGTTAAGTCGGGAGTTGGTTTTCG
GTGGGTGAAAAACTTGAAAAGATAGTTGAATAATGTAAAG
ATGGAAACTGTTTTAATGGAAGCTAGCAGCTCGGGTGCGT
TCAAATTTGGTTTGCACTTATGATATTACACGCTGAAATG
ATTGTCTCAAGGTTTTTGATGTGCGCTGGTACTTAGACGT
CTGCTTTTTATATTGCTGTAAATGTCACCTCCTGTTGAGG
TGTGGCATCTTCTTACACTTGAACTGTAGAAATGATCAGA
TACGTGGACATTTTTGTTTTCTTTTGAAAAATCCTGCTGA
ATTTGTGGATAAAACTGGACCAAGAATGGTAATGAGATGA
AAAGTATACGTCTTTGTAATTGTCTGTACGTCTGCTTCCT
TTCCTCAAATCGTTTTCAGAAAAGGTTTATTGGCATACGG
ATGCGGAAAAACCTTTTCAGACTGCTGTTTTAGTCTGGAC
TAAGTTTGTACTAGACTCTTCATCTCTATCTCATTGATGC
TGTATTCATTTCTACAGTCTTTAATGATAGAAGGAAAAAC
AAAAAAAAAAAACAAACAAACAAACAAAAGATGTTGTCCA
AAATCTGTGTGCCTTTTTTTGACGTATTAAAATTGCAGTA
AGACGGAGTTCCTGATGTTTAGCTTTCTGGAATGTGTAAC
GTTGAGGATATTATTAGCATTGTTTCATGGAGATATATGA
ATACTAGAAACGTTTATAGAAGAGAAATAACTCCAATATT
CTGAATTCTCTTGTTACTTTTTAATTTAAAATTGTTATTA
TTGTTTGGTCCATTTTTACAAGAATGTATGTCATTTATTT
TTGTACATTTACCACAGAACATAATTTTGACTCCTTTCCC
ATTTTGTAGACTTATATACCTTGGTGCCCCCACCAGTGAC
GATATAGAGCCACATTGCACTGCTACGAGTGTGAAAT

b4galnt4a TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript b4galnt4a-202 (1)    Ensembl 514
mRNA b4galnt4a-201 6357
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
b4galnt4a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000056610 (1),  Ensembl_Trans:ENSDART00000083407 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CN503365 (1) 964 bp
CITATIONS (2)