Transcript

actc1c-201

ID
ZDB-TSCRIPT-131113-4159
Name
actc1c-201
Previous Names
  • dkey-151e22.1-002
  • zgc:86725-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056467 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056467|OTTDARG00000039328|ZDB-GENE-040625-46 zgc:86725|OTTDARP00000044280 DKEY-151E22.1-002 LG_ CR382374.13 Danio rerio protein_coding KNOWN, 1352 bp
ACTCTCTTAGTTTTCAACCGCTCTTGAGGGAGCAAGTTTT
CCAGGCCTCTTGTTTCAAGCTCTCCCGGCTGTCTAAGCAA
ACATGTGCGACGAGGAAGAGACCACCGCTCTGGTGTGTGA
CAATGGCTCAGGTCTGGTGAAGGCCGGCTTTGCTGGGGAT
GATGCTCCCAGAGCCGTGTTTCCCTCCATTGTGGGCCGAC
CACGCCATCAGGGTGTGATGGTGGGTATGGGTCAGAAAGA
CAGCTATGTAGGAGACGAGGCCCAGAGCAAGAGAGGCATC
CTCACCCTCAAATACCCCATTGAGCATGGCATCATCACCA
ACTGGGACGACATGGAGAAGATCTGGCATCACACCTTCTA
CAATGAGCTCCGTGTGGCCCCTGAGGAACATCCAGTCCTC
CTTACTGAAGCTCCTCTAAATCCCAAAGCTAACAGAGAGA
AGATGACCCAGATCATGTTTGAAACCTTCAACGTTCCAGC
TATGTATGTTGCCATCCAGGCTGTGCTGTCACTGTACGCT
TCTGGCCGTACCACAGGTATCGTGCTGGACGCTGGTGATG
GCGTGACCCACAATGTGCCCGTATATGAGGGTTATGCCCT
TCCACATGCTATCATGAGACTGGATTTGGCCGGCAGAGAC
CTCACTGACTACCTGATGAAAATCCTGACTGAGAGAGGCT
ACTCATTCGTCACTACTGCCGAGAGGGAGATTGTTCGTGA
TATTAAGGAGAAGCTGTGCTACGTGGCTCTAGATTTCGAG
AATGAAATGGCCACCGCCGCCTCCTCTTCCTCTCTGGAAA
AGTCCTACGAGTTGCCCGACGGTCAGGTGATCACCATCGG
TAACGAGAGGTTCCGCTGCCCTGAGACCCTCTTCCAGCCC
TCCTTCATCGGTATGGAGTCTGCTGGTATTCATGAGACAA
CTTATAACGGCATTATGAAGTGTGACATTGACATTCGTAA
GGATCTGTATGCTAACAACGTCTTGTCTGGTGGTACCACC
ATGTACCCTGGTATTGGTGACAGGATGCAGAAAGAGATCA
CAGCTTTGGCTCCCAGCACTATGAAGATCAAGATGATTGC
CCCTCCTGAACGTAAATACTCTGTCTGGATTGGCGGCTCC
ATCCTGGCCTCCCTGTCCACTTTCCAGCAGATGTGGATCA
GCAAAGATGAGTACGAAGAGGCCGGACCCTCCATTGTCCA
CAGGAAGTGCTTCTAAACCCCCCTCCTCTCTTCTTCATTC
ACCTCCATCTTGGACTCTCCTCCTTCTCTTGCATCTTGTG
TCTCGAAATCCCCCTGTACAACAACTCGCATCTCCAGCCA
CAATAAATTGCTCAATAAACACATTTACTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations