ZFIN ID: ZDB-TSCRIPT-131113-4159
Transcript Name: actc1c-201
Previous Names: dkey-151e22.1-002, zgc:86725-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056467 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056467|OTTDARG00000039328|ZDB-GENE-040625-46 zgc:86725|OTTDARP00000044280 DKEY-151E22.1-002 LG_ CR382374.13 Danio rerio protein_coding KNOWN, 1352 bp
ACTCTCTTAGTTTTCAACCGCTCTTGAGGGAGCAAGTTTT
CCAGGCCTCTTGTTTCAAGCTCTCCCGGCTGTCTAAGCAA
ACATGTGCGACGAGGAAGAGACCACCGCTCTGGTGTGTGA
CAATGGCTCAGGTCTGGTGAAGGCCGGCTTTGCTGGGGAT
GATGCTCCCAGAGCCGTGTTTCCCTCCATTGTGGGCCGAC
CACGCCATCAGGGTGTGATGGTGGGTATGGGTCAGAAAGA
CAGCTATGTAGGAGACGAGGCCCAGAGCAAGAGAGGCATC
CTCACCCTCAAATACCCCATTGAGCATGGCATCATCACCA
ACTGGGACGACATGGAGAAGATCTGGCATCACACCTTCTA
CAATGAGCTCCGTGTGGCCCCTGAGGAACATCCAGTCCTC
CTTACTGAAGCTCCTCTAAATCCCAAAGCTAACAGAGAGA
AGATGACCCAGATCATGTTTGAAACCTTCAACGTTCCAGC
TATGTATGTTGCCATCCAGGCTGTGCTGTCACTGTACGCT
TCTGGCCGTACCACAGGTATCGTGCTGGACGCTGGTGATG
GCGTGACCCACAATGTGCCCGTATATGAGGGTTATGCCCT
TCCACATGCTATCATGAGACTGGATTTGGCCGGCAGAGAC
CTCACTGACTACCTGATGAAAATCCTGACTGAGAGAGGCT
ACTCATTCGTCACTACTGCCGAGAGGGAGATTGTTCGTGA
TATTAAGGAGAAGCTGTGCTACGTGGCTCTAGATTTCGAG
AATGAAATGGCCACCGCCGCCTCCTCTTCCTCTCTGGAAA
AGTCCTACGAGTTGCCCGACGGTCAGGTGATCACCATCGG
TAACGAGAGGTTCCGCTGCCCTGAGACCCTCTTCCAGCCC
TCCTTCATCGGTATGGAGTCTGCTGGTATTCATGAGACAA
CTTATAACGGCATTATGAAGTGTGACATTGACATTCGTAA
GGATCTGTATGCTAACAACGTCTTGTCTGGTGGTACCACC
ATGTACCCTGGTATTGGTGACAGGATGCAGAAAGAGATCA
CAGCTTTGGCTCCCAGCACTATGAAGATCAAGATGATTGC
CCCTCCTGAACGTAAATACTCTGTCTGGATTGGCGGCTCC
ATCCTGGCCTCCCTGTCCACTTTCCAGCAGATGTGGATCA
GCAAAGATGAGTACGAAGAGGCCGGACCCTCCATTGTCCA
CAGGAAGTGCTTCTAAACCCCCCTCCTCTCTTCTTCATTC
ACCTCCATCTTGGACTCTCCTCCTTCTCTTGCATCTTGTG
TCTCGAAATCCCCCTGTACAACAACTCGCATCTCCAGCCA
CAATAAATTGCTCAATAAACACATTTACTGTA

acte1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA actc1c-201 1352
actc1c-202 (1)    Ensembl 387
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
actc1c-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000056467 (1),  Ensembl_Trans:ENSDART00000109883 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC071401 (1) 1381 nt
CITATIONS (2)