ZFIN ID: ZDB-TSCRIPT-131113-2562
Transcript Name: actc1c-202
Previous Names: dkey-151e22.1-001, zgc:86725-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056466 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056466|OTTDARG00000039328|ZDB-GENE-040625-46 zgc:86725|OTTDARP00000044279 DKEY-151E22.1-001 LG_ CR382374.13 Danio rerio protein_coding KNOWN, 387 bp
TCAATGTCAGCTGTCCTGTTTAAGGTTTCATCATAACCTT
ATCCATTATCAGAGATCTGTGTTTTCTGACAGTGATTCAG
AGGATTACGCTGACAGTAATGACAGCTGAGAAAAGCTGTC
TAAGCAAACATGTGCGACGAGGAAGAGACCACCGCTCTGG
TGTGTGACAATGGCTCAGGTCTGGTGAAGGCCGGCTTTGC
TGGGGATGATGCTCCCAGAGCCGTGTTTCCCTCCATTGTG
GGCCGACCACGCCATCAGGGTGTGATGGTGGGTATGGGTC
AGAAAGACAGCTATGTAGGAGACGAGGCCCAGAGCAAGAG
AGGCATCCTCACCCTCAAATACCCCATTGAGCATGGCATC
ATCACCAACTGGGACGACATGGAGAAG

acte1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA actc1c-201 (1)    Ensembl 1352
actc1c-202 387
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
actc1c-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000056466 (1),  Ensembl_Trans:ENSDART00000155770 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN319843 (1) 900 nt
CITATIONS (2)