Transcript

actc1c-202

ID
ZDB-TSCRIPT-131113-2562
Name
actc1c-202
Previous Names
  • dkey-151e22.1-001
  • zgc:86725-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056466 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056466|OTTDARG00000039328|ZDB-GENE-040625-46 zgc:86725|OTTDARP00000044279 DKEY-151E22.1-001 LG_ CR382374.13 Danio rerio protein_coding KNOWN, 387 bp
TCAATGTCAGCTGTCCTGTTTAAGGTTTCATCATAACCTT
ATCCATTATCAGAGATCTGTGTTTTCTGACAGTGATTCAG
AGGATTACGCTGACAGTAATGACAGCTGAGAAAAGCTGTC
TAAGCAAACATGTGCGACGAGGAAGAGACCACCGCTCTGG
TGTGTGACAATGGCTCAGGTCTGGTGAAGGCCGGCTTTGC
TGGGGATGATGCTCCCAGAGCCGTGTTTCCCTCCATTGTG
GGCCGACCACGCCATCAGGGTGTGATGGTGGGTATGGGTC
AGAAAGACAGCTATGTAGGAGACGAGGCCCAGAGCAAGAG
AGGCATCCTCACCCTCAAATACCCCATTGAGCATGGCATC
ATCACCAACTGGGACGACATGGAGAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations