Transcript

angel1-202

ID
ZDB-TSCRIPT-131113-4033
Name
angel1-202
Previous Names
  • angel1-002
  • ch211-173a9.9-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055895 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055895|OTTDARG00000038984|ZDB-GENE-111020-12 angel1|OTTDARP00000043824 CH211-173A9.9-002 LG_ AL935141.16 Danio rerio protein_coding NOVEL, 798 bp
CCAGGAGAGGAGACGTGAAGCTGGCCCAGCTCGCCATCAT
GTTCGCCGAGATCCACAGCGTGATGCAGAAATGCAGGAGT
GAAGGGAAAAGCTGCGAGCTGATTCTGTGCGGAGACTTCA
ATGCTGTACCCAGGAGTCCTCTGTGGACGCTGATCACCAC
CGGGGAGCTCTACTACCACGGCCTACCGACATGGATGATG
GTAAACAGCAGTACAGTCATGAGTTCATGTGTCAGCTGCG
CTTCTGTGAGGCGGCGTGTGTTCGGCCTGCAGATCTAGAG
CTCATACCCGGAGTCACAGACAAAACACCCGACCTAAGAG
ACATGTTTAGTCTAAGGTTCAGTCCTTCTTTACGTCACAG
GTTGAGTCTGACGTCTGCTTACAGTCATATTCATCCCGAA
ACTCTGACTGACCTGGTCACGACACTGAACTCTGAAGGAG
CTGCCATGGTCGACTACATCTTCTACTCCCAACGGCAGAA
GAGCGGCTTCAACGGAGGCGGAGAGAGCGCTGGTGGTCTG
AAACTGCTGGCTCGTCTGTCTCTGCTGTCTGAAGCTCATC
TCTGGTCTCTGCGAGGTTTACCCGATGAAAGCTTCCCCTC
TGATCATCTCAGCCTGCTGGTCAAACTTCAGCTCAGCTCA
GCGGATATATGACCACGCTAGCACTCGTCTTCTTTATTAT
TTTAACTGCCTTTGTATTGTAAATCGCACAAAGAAATTCA
GTTTTGGTCAGATCAGTATTTTGTTGTGTATTCAGAATTT
TCAGTGTATGTGTGTTTATTACAATCTACCATGTGAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations