Transcript

angel1-201

ID
ZDB-TSCRIPT-131113-2442
Name
angel1-201
Previous Names
  • angel1-001
  • ch211-173a9.9-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055894 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055894|OTTDARG00000038984|ZDB-GENE-111020-12 angel1|OTTDARP00000043823 CH211-173A9.9-001 LG_ AL935141.16 Danio rerio protein_coding NOVEL, 2348 bp
CAAAGTTTGGGGAGGCGCGGCTGTCTGTGGGCAGTGACGT
CACTCCGCCGGCGTCTGTCGTGTCGTCACGCCGCTGTCGC
CCCCTCGTGCTGGTTCGCTGTTCTGCTGCTGAATAATATA
AAGTTAGCGGCTTTTCCAGATGATCGTCAGTGCGATGTTT
TATGCGCTTTATCCGCTTTCCAGACTCCTCGACAGAGTTT
CAGCAGCGTGGCAGAAGCCTCCGCCAGTGCATGTGAATGG
CAGAGAGGTTTGGGACGGTGGAGGACAGCAGCAGCAGCAG
ACGGAGGACTCACTGCAGAGGAACAGCACAGAGAGATCAG
CACAGCTTCCACAAGACAAACACACTCACACACACCTTCC
TCAGGGAACACTGGTGGAGACTCTAGAGAGAGCACGAGCA
GAAGAAGAGCTGCAGAAAACTCTGTGTGATGTCAGTCAGA
TGGAGGGAGTGCTGTCAGAAACACCGCTCGCCGGTCTGGA
GGACACACACAATCCACAACCTGTGAAGAACCAGGCTGAA
TCTGACTATGTGTTCAGCTCAGTAGCTGGAAAACACAGCG
AGATCTCTCCACATCTGACTGCAGACGCTCCCTCAGAAGC
AGACCGGTGTGATGGTGTGTCTGCCAGCTCTGGAGGTGCA
GCTCTTCTCCTCGCGTCCCGCAGCCCAGTGTTTGACCTGT
CAGCTTTACTGTCGGACACACAGCAGCTCCAGATGGATGC
TGAGCCCATCGGGTGGCACTTTCCTGTCGGACACGGCCTG
GCGGAGATGTGCTACTGTCCTTACGTGCAGTTTCCCGACG
TCAGCTACTATCCTGCATTTCAAGACCAGGACAATATAGA
AGTGATGTGGCGAGTGTGGGAGGACCTCAGTGAACCGCAG
AGCAGTGACAGTGCAGACGCGTCTCCTGTGTTCGACTTCA
GCGTCATGTCTTATAATATCCTGGCTCAGGATCTGCTGGA
AGCCAATCCACATCTGTACACACACTGTGCGGAGGACGCG
CTGAGGTGGGAAAACCGGCTCCAGGCTGTCCTGAAGGAGC
TGCAGATCTGGCAACCAGATATTGTTTGTCTTCAGGAAGT
GCAGGAGGATCACTTTCAGGAGCAGATGCATCCCGTCCTG
ATCAACATGGGTTATACATGCATCTATAAGCGTCGCACAG
GCTCAAAAACAGACGGTTGTGCTGTGTTATACCGCGGTGA
ACGCTTCACTCAGCTCTCCGTCAGTCTGCTGGAGTTTCGC
CGCTCGGAGTGTGAGCTGCTGGATCGGGATAATGTAGGCA
TCGTGCTGCTCCTCCAGCCCACGGCGGGACCCCATCATCA
GTTTACACCGGTGTGTGTTGCTAACACACACCTCCTGTTC
AACCCCAGGAGAGGAGACGTGAAGCTGGCCCAGCTCGCCA
TCATGTTCGCCGAGATCCACAGCGTGATGCAGAAATGCAG
GAGTGAAGGGAAAAGCTGCGAGCTGATTCTGTGCGGAGAC
TTCAATGCTGTACCCAGGAGTCCTCTGTGGACGCTGATCA
CCACCGGGGAGCTCTACTACCACGGCCTACCGACATGGAT
GGTTTCAGGGCAGACGGATTTGTCATATAAAGCTCATCAC
AACAGGCTTTTCTCCCCATTGTGGCCCAGCAGCCTCGGCA
TCACTGACCGCTGCCAGTACAACACTGACACACACACCAC
AGCTTCAGATGGTAAACAGCAGTACAGTCATGAGTTCATG
TGTCAGCTGCGCTTCTGTGAGGCGGCGTGTGTTCGGCCTG
CAGATCTAGAGCTCATACCCGGAGTCACAGACAAAACACC
CGACCTAAGAGACATGTTTAGTCTAAGGTTCAGTCCTTCT
TTACGTCACAGGTTGAGTCTGACGTCTGCTTACAGTCATA
TTCATCCCGAAACTCTGACTGACCTGGTCACGACACTGAA
CTCTGAAGGAGCTGCCATGGTCGACTACATCTTCTACTCC
CAACGGCAGAAGAGCGGCTTCAACGGAGGCGGAGAGAGCG
CTGGTGGTCTGAAACTGCTGGCTCGTCTGTCTCTGCTGTC
TGAAGCTCATCTCTGGTCTCTGCGAGGTTTACCCGATGAA
AGCTTCCCCTCTGATCATCTCAGCCTGCTGGTCAAACTTC
AGCTCAGCTCAGCGGATATATGACCACGCTAGCACTCGTC
TTCTTTATTATTTTAACTGCCTTTGTATTGTAAATCGCAC
AAAGAAATTCAGTTTTGGTCAGATCAGTATTTTGTTGTGT
ATTCAGAATTTTCAGTGTATGTGTGTTTATTACAATCTAC
CATGTGAGGAAATCTGACACGGCGTGTATAATTGACAGTG
TTCCTAATTAATAAATCATAATTATACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations