ZFIN ID: ZDB-TSCRIPT-131113-2442
Transcript Name: angel1-201
Previous Names: angel1-001, ch211-173a9.9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055894 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055894|OTTDARG00000038984|ZDB-GENE-111020-12 angel1|OTTDARP00000043823 CH211-173A9.9-001 LG_ AL935141.16 Danio rerio protein_coding NOVEL, 2348 bp
CAAAGTTTGGGGAGGCGCGGCTGTCTGTGGGCAGTGACGT
CACTCCGCCGGCGTCTGTCGTGTCGTCACGCCGCTGTCGC
CCCCTCGTGCTGGTTCGCTGTTCTGCTGCTGAATAATATA
AAGTTAGCGGCTTTTCCAGATGATCGTCAGTGCGATGTTT
TATGCGCTTTATCCGCTTTCCAGACTCCTCGACAGAGTTT
CAGCAGCGTGGCAGAAGCCTCCGCCAGTGCATGTGAATGG
CAGAGAGGTTTGGGACGGTGGAGGACAGCAGCAGCAGCAG
ACGGAGGACTCACTGCAGAGGAACAGCACAGAGAGATCAG
CACAGCTTCCACAAGACAAACACACTCACACACACCTTCC
TCAGGGAACACTGGTGGAGACTCTAGAGAGAGCACGAGCA
GAAGAAGAGCTGCAGAAAACTCTGTGTGATGTCAGTCAGA
TGGAGGGAGTGCTGTCAGAAACACCGCTCGCCGGTCTGGA
GGACACACACAATCCACAACCTGTGAAGAACCAGGCTGAA
TCTGACTATGTGTTCAGCTCAGTAGCTGGAAAACACAGCG
AGATCTCTCCACATCTGACTGCAGACGCTCCCTCAGAAGC
AGACCGGTGTGATGGTGTGTCTGCCAGCTCTGGAGGTGCA
GCTCTTCTCCTCGCGTCCCGCAGCCCAGTGTTTGACCTGT
CAGCTTTACTGTCGGACACACAGCAGCTCCAGATGGATGC
TGAGCCCATCGGGTGGCACTTTCCTGTCGGACACGGCCTG
GCGGAGATGTGCTACTGTCCTTACGTGCAGTTTCCCGACG
TCAGCTACTATCCTGCATTTCAAGACCAGGACAATATAGA
AGTGATGTGGCGAGTGTGGGAGGACCTCAGTGAACCGCAG
AGCAGTGACAGTGCAGACGCGTCTCCTGTGTTCGACTTCA
GCGTCATGTCTTATAATATCCTGGCTCAGGATCTGCTGGA
AGCCAATCCACATCTGTACACACACTGTGCGGAGGACGCG
CTGAGGTGGGAAAACCGGCTCCAGGCTGTCCTGAAGGAGC
TGCAGATCTGGCAACCAGATATTGTTTGTCTTCAGGAAGT
GCAGGAGGATCACTTTCAGGAGCAGATGCATCCCGTCCTG
ATCAACATGGGTTATACATGCATCTATAAGCGTCGCACAG
GCTCAAAAACAGACGGTTGTGCTGTGTTATACCGCGGTGA
ACGCTTCACTCAGCTCTCCGTCAGTCTGCTGGAGTTTCGC
CGCTCGGAGTGTGAGCTGCTGGATCGGGATAATGTAGGCA
TCGTGCTGCTCCTCCAGCCCACGGCGGGACCCCATCATCA
GTTTACACCGGTGTGTGTTGCTAACACACACCTCCTGTTC
AACCCCAGGAGAGGAGACGTGAAGCTGGCCCAGCTCGCCA
TCATGTTCGCCGAGATCCACAGCGTGATGCAGAAATGCAG
GAGTGAAGGGAAAAGCTGCGAGCTGATTCTGTGCGGAGAC
TTCAATGCTGTACCCAGGAGTCCTCTGTGGACGCTGATCA
CCACCGGGGAGCTCTACTACCACGGCCTACCGACATGGAT
GGTTTCAGGGCAGACGGATTTGTCATATAAAGCTCATCAC
AACAGGCTTTTCTCCCCATTGTGGCCCAGCAGCCTCGGCA
TCACTGACCGCTGCCAGTACAACACTGACACACACACCAC
AGCTTCAGATGGTAAACAGCAGTACAGTCATGAGTTCATG
TGTCAGCTGCGCTTCTGTGAGGCGGCGTGTGTTCGGCCTG
CAGATCTAGAGCTCATACCCGGAGTCACAGACAAAACACC
CGACCTAAGAGACATGTTTAGTCTAAGGTTCAGTCCTTCT
TTACGTCACAGGTTGAGTCTGACGTCTGCTTACAGTCATA
TTCATCCCGAAACTCTGACTGACCTGGTCACGACACTGAA
CTCTGAAGGAGCTGCCATGGTCGACTACATCTTCTACTCC
CAACGGCAGAAGAGCGGCTTCAACGGAGGCGGAGAGAGCG
CTGGTGGTCTGAAACTGCTGGCTCGTCTGTCTCTGCTGTC
TGAAGCTCATCTCTGGTCTCTGCGAGGTTTACCCGATGAA
AGCTTCCCCTCTGATCATCTCAGCCTGCTGGTCAAACTTC
AGCTCAGCTCAGCGGATATATGACCACGCTAGCACTCGTC
TTCTTTATTATTTTAACTGCCTTTGTATTGTAAATCGCAC
AAAGAAATTCAGTTTTGGTCAGATCAGTATTTTGTTGTGT
ATTCAGAATTTTCAGTGTATGTGTGTTTATTACAATCTAC
CATGTGAGGAAATCTGACACGGCGTGTATAATTGACAGTG
TTCCTAATTAATAAATCATAATTATACA

angel1 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript angel1-202 (1)    Ensembl 798
mRNA angel1-201 2348
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
angel1-201 Contained in:
[BAC] CH211-173A9 (1)

Genome Resources: Vega_Trans:OTTDART00000055894 (1),  Ensembl_Trans:ENSDART00000109891 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EG582386 (1) 963 nt
GenBank:EE301570 (1) 919 nt
GenBank:CO248415 (1) 852 nt
GenBank:EB937089 (1) 674 nt
GenBank:BQ479842 (1) 643 nt
CITATIONS (2)