Transcript

cga-202

ID
ZDB-TSCRIPT-131113-4016
Name
cga-202
Previous Names
  • cga-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055832 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055832|OTTDARG00000038933|ZDB-GENE-040715-2 cga|OTTDARP00000043768 cga-001 LG_ CU896650.6 Danio rerio protein_coding KNOWN, 1793 bp
TCACGCTCCGCCGGAAGTCGAGAACAAAGCCATCATGTTT
TGGACAAGATACGCTGAAGCAAGCATTTTCTTGTTGTTAA
TGATTCTTCATGTCGGACAACTGTATTCAAGAAACGATGT
GTCTAACTATGGATGTGAAGAGTGCAAACTCAAGATGAAC
GAACGTTTCTCCAAACCCGGGGCTCCGGTCTATCAGTGCG
TGGGCTGCTGCTTTTCGAGAGCTTACCCCACACCCCTGAG
GTCCAAGAAAACCATGCTTGTCCCAAAAAACATCACATCA
GAAGCCACTTGCTGTGTAGCAAAAGAATCTAAAATGGTTG
CCACGAATATCCCACTATACAACCACACAGACTGCCACTG
CAGCACCTGTTACTATCATAAGTCTTAAAACACACTCTCT
TCACATTTCTCAAATGCTCATTTCCTGTTCTTAAATCACA
GTGACTCATGAAATATGATTTTTATGTAGCTTTCCATATT
TCAACTGTGGCCATTTCCAATTCGTTTCTAAAATGGTTGG
CATAATTATTGTAAACTGCATATTCTGTCACTTTCATAGA
CCTTAAAGGGATTGTTCACCTAAAAATTAAGATTCAAGTG
GGTGTCCAAACTCAGTCCTGGAGGTCTGATGTCCTGCAGA
TTTTAGCTCCAACTTGCCTCAACACACCTGCAAGGATGTT
TCTAGAAAGTCTAGTAAAGCTGCGGTGACATTAGAGTTTG
AGCATGCGATATTTTGTCGTGCGGCGCTGCGAAAAGAGGC
GGGATTTAACAAGCTTATTATACATTTTAAAAAGTAAGCA
ATTACTCCATATTTTAAATTCCTGTCCAGAGAGGTCATGT
TTTGATACTCGATTGGTCTCACGCAGTCAAGTGATGCGAT
TTCTCAGGTCAGAGTTCACCAAGCTTGAACTTTGCACCGC
AGCAACCTGCAAAACTTGACGCACAACCTTGCGCTTCCGG
TCTGACGCATTCACGTGCGTATGAATGGAAGTCTATGGGG
AGAAAAGTCAAGTGTGACCACAGCTTAAGAGCTTGATTAG
CTAGCCCAGGTGTGTCTGGTTGCGATTGGAACTAAACTTT
GCAGGACACCGGCCCTCCAGGACTAAGTTTGGACACCCCT
GCTCTAAACCTTTCCTTGCTGAAAATTCCAGCTTAAATCA
GCCTAGGATGGTTGGCTGGTTTTAGAGGGGTTTTAGGCAC
TACCAGACTGGTTTCCAGTCATTTCCAGCCTGGTCTTTGC
TGGTCAGGCTGGAAAGTGACCAGCTAAAACCATCTAAAAC
CAGCTTGACCATCCTGGTTTAAGCTGGACATAGCTGATTT
AGGCTGGGCTCCCAGGCTGGCTAGGCTGGTCAAGCATCTC
CCAGCTTGTCCAGCTAACACCTGGCTGGAAATGGCTGGAA
ACCAGCCTGGAAGTGGCCAAAACCCCTGTAAAATCAGGCT
GGTCGACCAGCTAAAACCAGTCAATCATCCTAGACTGGTT
TAAGCTGGATTTTTCAGCAGGGTTATGAGTTTCTTTCTTC
AGTTGAATGAACAATTTTAAAGAAAGCTGGAAACACCACT
AAAACTGAAGTCAGTGGTTTCCAGCTTTCTTCAAAGAGGA
AAGAAAGTTGAACAGATTTGAATGGAACAAGTAAAGGGTG
AGTAAATAATGACAGAATTGTAATTTTGGGTGAACTATCC
CTTTAAGAGCGTAATATGCCATCCTTTACTATCATTAAAT
CGCTTATTTATTTTGTTGCCTTTACTGTGACATTCTTCAA
ATCTATAAATGAAATAAAAGATTGCTGAAGACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations