Transcript

htr1b-201

ID
ZDB-TSCRIPT-131113-3966
Name
htr1b-201
Previous Names
  • htr1b-001
  • dkey-25g12.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055670 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055670|OTTDARG00000038817|ZDB-GENE-081022-141 htr1b|OTTDARP00000043654 DKEY-25G12.3-001 LG_ BX005484.7 Danio rerio protein_coding NOVEL, 1325 bp
GTCTGTCCGCAGCTGATGCTGGAGCTGAAGGAAATCATGA
AGAGAAGAAAATACTGCTTTATCTTCAAAATATGAAAACG
CATGTTTTCTTCTGGGATGGAGCGCAGCGGTTATTTCAAG
CCGACACCTGCCCATTTCGAGGTCTTGAACAGCTCGACCG
GCACCAATGTGACTTTGACACCTAAAACGGACGAAAAGCA
AGAAAGTTTCGCTTTCCAAGTCACCTTGTCGTCAGTTCTG
GGTCTCATCACTCTCGCAACAATATTAAGCAATGCGTTTG
TCATTGCCACCATTTCCCAATCCAGAAAGCTCCAGACACC
GGCGAACTTTCTGATCGCGTCGCTGGCCGTCACGGACCTT
CTGGTGTCGGTGCTCGTGATGCCCATTTGCGTGCTGTACA
CGGTCACCCGCGAGTGGACCCTCGGCCAGGTCATCTGCGA
CATCTGGCTGTCCTCAGACATAACCTGTTGCACCGCGTCC
ATACTTCACCTCTGCGTAATCGCCTTGGATCGATACTGGG
CAATAACGGACGCGGTCGAGTACGCCAAGAAACGCACCCA
GGCGCGCGCCGCGGGGATGGTGGCGACCGCCTGGATCATC
GCCATCTCCATCTCCCTGCCGCCTTTCTTCTGGCGACAGG
TGAAGGCAGGGGAGCTGACCACCTGCTCGGTCAACACAGA
TCACATCTTCTACACAATCTACTCCACTTTTGGGGCTTTC
TACATCCCTACGCTGCTGCTCATCGCCCTGTACGGGAGGA
TTTACGTGGAGGCGAGGAAGCGCATTTTGAAGCAGTCGCC
CAAAAAACCGGGCAAAAGACTCACCTCTGCACATCTGAGC
ACTAATTCGCCCGCTTCGGTGGCTTCGACTTCGCCTTTGC
ATTGCGGAAGGCAGGACCTTTGCTCGGACAGCGGGTCTCT
GGGCAGTGACAATCAAATTAGAGTAACTGTGTCCGATTCA
CTTCTGGAGAAAAAGAGAATATCGGCTGCGCGCGAGAGGA
AAGCCACCAAAACCCTGGGCATTATATTAGGAGCTTATAT
TGTGTGCTGGCTGCCGTTTTTCATTTACACACTGTTGATT
CCCCTCTGTTCGTCTTGCTTTTCCCCAGAACTCTTTGACT
TTTTCACTTGGCTTGGCTACGTCAACTCACTCATCAATCC
TATAATATACACCATGTCCAATGATGACTTTAAAAAGGCT
TTTCATAAAGTCATAAGTTTTAGATGTTGCAGACGATAGG
AAAAATAAGTAGACCCATAAGGGATAATGATCAGTCAGTC
ATTATCATTATCGCAAGTGATATCACGGCACTGTTGAATG
CTTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations