Transcript

strn3-201

ID
ZDB-TSCRIPT-131113-3938
Name
strn3-201
Previous Names
  • strn3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055562 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055562|OTTDARG00000038753|ZDB-GENE-030616-405 strn3|OTTDARP00000043578 strn3-001 LG_ BX324186.12 Danio rerio protein_coding KNOWN, 4060 bp
ACATCCAGGGATCGGACTAATGGCGGCCGGCAAATCCGTG
CGCTGACACGAAAACCACAACAGCCGCTCAGGTGCCAGCC
TATTCGGTTGGGGGCAGGGCGACGTCGCATCGCTAAGCGA
ACGGTAAAAAAGGGAGGGTAGAGGGGTAACAATCGGCGAC
TTCTAGCAGGACTTTCCTATTTTTAAACATGGATGAACAG
CCCGGAGGAGGAGGAGGTGGTGGTGGTGGAGGAGGAGGAG
GAGGAATGGCCGCCCAGAGGCAGCAGCAGCAGCCCGCACC
GCAGCAGGGCAACAACAGCATTAATCCTCAGATGAACAGC
GCTGGAGGAGCGCCTATGGTTCAGCAACAGCAAGACGAGA
TGCCCAGGCCCCAGCAGTACACCATCCCGGGGATTTTACA
CTACATCCAGCACGAATGGGCCCGTTTCGAGATGGAAAGG
GCGCATTGGGAAGTGGAGAGGGCCGAGCTCCAGGCCCGAA
TAGCATTCCTCCAAGGAGAAAGGAAGGGGCAGGAAAATTT
AAAGAATGACCTTGTTAGAAGAATAAAAATGTTAGAATAT
GCATTAAAGCAAGAAAGAGCAAAATACCATAAATTAAAAT
ATGGGACAGAACTTAATCAAGGTGAAGTGAAAATGCCTAG
CTTTGAATCAGAAGATACCAAAGATACAGAGGTCTCAGCT
ATACCACAGAATAGCCAGTTAACGTGGAAACAGGGCAGGC
AACTTCTCAGACAATATCTTCAGGAAGTAGGTTATACGGA
CACAATACTGGACGTCCGGACGCAGCGAGTGCGGTCATTA
CTAGGACTGTCTGGCTCAGAGCAGAATGGTTCCGTGGAAA
CCAAGAACCTAGAACAAATTCTAAATGGAGGCGAATCTCC
AGCCAAAAGAAAGGGACAAGACATGAAAAGGAATCCAGAA
GTTCTGGAGACATTTAATTTTTTAGAAAACGCTGATGATA
GTGATGAAGAAGATGATGATGAGGGTGATATAATGGAGGA
TGTGCCTGACAGGAGCGATAAACGCAGAATAAAAAAACAT
AAGATTAAGGTCGGAAATGAAGGATTGGCTTCAGACTTGC
CGGATGACCCTGACACAGAGGACGCACTCAAAGAGTTTGA
CTTTTTGGTGAATGCAGAGGATGGAGAAGGTGCTGGGGAA
GCTCGGAGTTCTGGAGACGGCACAGAGTGGGCTGAGCCTC
TGCCATTCACGCCTGGTGGGGGCAAGTCCTTTATCATGGG
TTCTGATGACATGTTGGAAAGTGTGCTGGGCCTGGGAGAC
CTCGCCGATCTGACTGTTTCCAATGACGAGGCTGAATACA
GCTATGATCTGCCAGCCAATAAGGATGCATTCAGGAAGAC
ATGGAATCCCAAATATACCCTGCGTAGCCACTTTGATGGA
GTGCGAGCCCTGGCTTTCCATCCTGTAGAGCCGGTGCTGG
TCACAGTCTCAGAAGATCACACGCTCAAACTGTGGAACCT
CCACAAGACCGTTCCTGCCAAAAAAAGTGCCTCTTTTGAT
GTGGAGCCTATATACACGTTTAGAGGGCATATTGGGCCTG
TGCTCTCATTGGCTGTGACCTCGAGCGGTGAGCAGTGTTT
TAGTGGTGGAATCGATTCGACAATACAATGGTGGAACATC
CCCAGCTCTAACGTAGACCCTTACGACACATATGATCCCA
GTGTGTTGGCTGGTACGCTGTTGGGTCACAGCGATGCCGT
TTGGGGTTTGGCTTACAGTGGGATCAAGAACCGTCTGCTC
TCCTGTTCAGCTGATGGGACAATCAAGCTGTGGGACCCTC
AAGAGAAGATCCCGTGTCTTAGCACTTTTAACTCTGATAA
AGATCATGGTGTTCCCACATCAGTTGATTTTAATGGGTGC
GATCCAGCTCATATGGTGGCGTCTTACAACACTGGAGATG
CTGTTGTTTATGATCTGGAGACATCTCAGCCTGTAGTTGT
GTTCTCTGCACAGGGAGAGAGTGCTATTCCTTTTGGGAAT
CACATCAATAAAGTAGTCACTCACCCCACCCTGCCAATCA
CAGTCACCGCTCATGAGGATAGACACATCAAATTCTTTGA
CAATAAATCAGGTAAAGCCATCCATGCGATGGTGGCTCAC
TTGGATGCTGTTACTAGTCTGGCAATTGATCCAAATGGCA
TCTACTTGATGTCAGGAAGTCACGATAGTTCAATCCGCTT
ATGGAACCTGGACAGTAAGACTTGTGTACAGGAAGTCACC
GCTCACAGGAAAAAGTCGGACGAGGCCATATATGACGTTG
CCTTCCACCCATCGAAGGCATACATAGGAAGTGCCGGAGC
CGATGCCCTGGCCAAAGTGTTTGTATAAAGGCACGCCCAT
ATTACCACATCCACAAAGACAGACAGACAGACAGAGAGAA
AGAAAGGACTGCTTCACTGCCTTGTGTAACAAGAGTAGCA
TTTCTCACACTACATTGAAGTGGCTTCCACCTTCGGTGTC
AAACTCACACCACACACACAACGAATACCAGGTGCCAAGA
AGGGGACGTGCCGTTTCTTTTTTCGCGAAGCCAGTGTGGA
GTGCTCAGTCAGTTTTAATCTTTATTTTTGTTTCCTGAAA
AAAAGCAAGAAAAAAAAACAGAAAAAATACCTGTAATTTA
CTGTAAGCTGGAGTGAAACCAGTGCTTGTAGCCTTTTGAC
TGGTTCTGAACTGAGCTGATAATGTGTCCTGTAGGTTTGT
TTCAGTGACCATGGAGTGGCTGTTTATGTTCATCCATCAG
TAGGTTTTCATCAACCGTCATCAGGGGCACCTGAGGAACC
CAGTCCCACCCTGCCGAGCCATAAAACCAGACCCCGATCT
CATCCTAATGTAGCGTGCAAACCAATACAGTTAAACTCAG
TCAACCTTCATACCTTTAGCGTTTGTTTCTTTTTTGTGTA
AAAAAGTATAGTTTTTATAATCAATTTTATATAAATAAAG
ACTGTCATAAAAGCGCTGAAAATCACATTTTTTAAAGGGA
CTATAATCCCACTCGAGCCCTCCATTTCCCGCGGTTCTCC
TTCACAAAGTTCTTGTGTATCCGGAAAGCCTGGATGAATG
CTCTCCTTTACACTTACTACATTGCTTTAATGTTGTTTTG
TCATCACGTAACGGAGAGACTGTACGCCAGTAGAAGCACA
GCGCGTGGTGACATGAGAGCTTATAGGAATCTACAAATAA
ACTGCAGCATCCTGTCACTATGTGATGTTTCTGTACACCT
TACTGTAAAATGAGTTGAAGTATCACAAGTTAGAAATCCG
AACGCTATTTATTTTCAGTCTGTGGATAGTCTTATCCTTT
GTTGAGAGCGCATAGCTCGACGGTGACTACAATGTCGGGC
TGTTGCTAACCAAACGGAACAGGTCATTCGATAAGTGAGA
TTAATGTGAAAGCTCTTTTTAAAACACGGTTTCTTAGTTG
GCTAAAAATGGCGTTTAAATCACCTCACGATGCCGGAGAT
CAGGTGAGAACTGTTTTTAAAGTTAAAGGGATGGTTCACC
TCTAAATGAAAATGCTGTTGTCGTTTACTCGCCTTCATGT
CTCTATAAAGCAATATGACTGATTTTCATCTGTGCGACAT
AAAAGAAGCTATTTTGAAAAATGTCCTGAAACTTAAGACG
CAAACATACCTTCTTTTGTGTGTGTCTGTTCCCGTGGAAA
AGACCTTCATGTTGGTTTAAAACGACACGGGGGTGATTAA
ATGACGACGTCACATTTGGAATTTGAATACTGCGTAATAA
CATTTGCTTTGTGGTCCTTCTGCCCCCCAATCAATTTTTA
AAGGAAACGATGCAGTTTATGGTGTAACAAAAGACCTTTT
TGTTTGTGTAATGCATGATTAATACTAAAAAATAAAGTAT
TTTTTCTAGTCTTCCAAAAGTTCTGATCAGTTTGAAGAGT
TTTGATGAGTTTTGTAAGGTTTTTGATTTACTACGAATCA
ACAGATTTTAAAGATTGTACCACATAGCAAAACAACTGTT
GAAAAGTAATGTATATAAAATGTCTATAATAAATATTAAA
TGGTGTATCTGTATATGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations