ZFIN ID: ZDB-TSCRIPT-131113-3937
Transcript Name: mdga2a-201
Previous Name: mamdc1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055559 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055559|OTTDARG00000038751|ZDB-GENE-030616-360 mamdc1|OTTDARP00000043575 mamdc1-001 LG_none BX511062.12,BX465838.15 Danio rerio protein_coding KNOWN, 4138 bp
GTAGTCAGCCAGCTGGGCTCCGGCGTTCCAGCGCAGTACG
TATGGCGCAGCGTGCCCGAGCACTCTTCACATTTCATCCA
CTCTAAATCACGCTTTATCCCGAAAATAGGCATCTGTTTA
CGTGTCATCGATTTATTTATTTATTTGATATGTTTTCCCC
CCTCTAGAAGTAAATCTGACACACACAGCTCTTATGAAAT
AACGGATTCATCTTTTTTTCCATCCTCTTTCCGCTGGAGA
CGAAGAACCACAGTGTTTCAGCTTCCTCGGCGTGCCTTTC
TGCCTCACCGGCATCCTGTAATCACGAAGAGGATGTGAGC
GGCGATTACTGTTCATTTTTCGCATTAAATTCCGCAGTCT
TATCTTTTGGGAACGTCGACGAGGTGGATGCCAGCGCGCG
TAACCGATTAACAGCGCGCGTGTTTCCCGTGGCGCTGTCA
TTTACTTTCGCCAGTCGCGTCGGTGCTTAATGCCGGCGGA
GGTGCGAGGAGGAGACCGGCTCTGAAGGTTTCATACTCGT
CCTCCTCATCTGTCACGGCTTTATTTCTCCGCCTGGACCA
ATTTAGCGAAAACATCTGCATTGAATTGGCAAGAAATGAC
TGATGAGGCTTCTCTGACTGACACTACTTCAGCTGTTTCT
TGATGATACGGTCACGCGAGGTGGGAGATTTGGACTGCAC
GTACTGCCTTCAACTGTTCGCCGCCTGAGGAGCTGGATAT
GTGCAGACTAACGTGAAGATGGATATTATCTGGGCTCTCC
TGTGGTTATTGGCCGCACTGTTTGAAGGTGTTTTTTGCCA
GGGAGTTTACGCTCCACCAACCGTTCAGATCATTCACTCC
GGTCACGCATGCAACATTGAGGAGGAGCGCTACACGGAGA
GGGTGTACACCATCCGCGAGGGGGAGACTTTGGAGCTGAC
CTGCCTGGTGTCGGGACATCCACGGCCACAGATACGATGG
ACAAAGACTGCAGGAAGTGCTACTGACCGCTTTCAGGACT
CAAGCGTATTCAACGAGACGCTGCGCATAACCCGGATCCA
GAGGCACCAGGGGGGCCGCTATTACTGTAAAGCAGAGAAT
GGCCTCGGCACTCCAGCCATCAAATCCATCCGAGTGGATG
TGTACTATTTAGATGACCCCATTGTGACGGTCCATCAGAG
TATAGGAGAAGCCAAGGAGCAGTTTTACTATGAAAGGACT
GTGTTCCTGCGGTGTGCTGCCAATTCAAACCCTCCAGTGC
GGTACAGCTGGAGACGGGGCAGAGAGTTCCTTTACCAGGG
CTCAGACAAAGGTGTGGAGATCTACGAGCCGTTCTTCACC
CAGGGGGAGACCAAAATCCTGAAGCTGAAGAACCTGCGTC
CTCAAGACTATGCCAACTACACCTGCACTGCCTCCGTCCG
CAGTGTCTGTGGCATCCCTGACAAGAGTGTGCTGTTCCAG
CTCACCAACAAAACCGCCTCCCCGACTATTAAGCTGCTTG
TGGAAGATCCTATTGTGGCCAATCCTGGGCAGACAGTGAC
CCTGGTGTGCATCATCTCTGGAGGCGAGCCCAGCCCGACC
CTCTCATGGGTCAGGAACACAGAAGAGCTTCCAAAGAAGA
GTGTCCTCAATGGTGGAACCCTTACTATTCCTGCCATCAG
CACAGATGATGCTGGTGTTTACAGCTGTGTAGCCAGCAAC
AACGTGGGTAATCCTGCAAAGAAATCCACCAACATTGTTG
TCAGAGCTCTGAAGAAGGGCCGCTTCTGGATCACTCCCGA
CCCCTACCATAATGACGACAACATCCAGATTGGCCGCGAG
GTGAAGATCTCGTGTCAGGTGGAGGCCACACCGCCCGAGG
AGCTCATGTTTAGCTGGCTGAAGAATGGCCGTCCTCTCCG
CAGCTCAGAGCGCATGGTCATTACCCAGACTGACCCGGAC
GTCGCCCCAGGAACCACAAACCTGGACATCATTGACCTCA
AGTTTACTGACTTTGGCACGTACACCTGTGTGGCCTCGCT
GAAGAACGGTGGGATACCAGAGATTAGCATAGACGTCAAC
ATCTCCTCCACCACGGTTCCACCCAACCTGACTGTCCCCA
GAGGAAAGTCCCCTTTGGTCACTCAGGAGGGTGACACTGT
AGAGCTCCAGTGCCTGGTCTCCGGCAAACCCAAACCCATC
ATCATCTGGTCTCGTGCTGATAAAGAAGCGCCCATGCCAG
ATGGCAACATGCAGACCGAAAGCTACGACGGAGTTCTGCG
CATTGTCAATGTCTCTCGCGAGATGACAGGAACATACCGC
TGCCAAACCAGCCAGTACAACGGCTTCAACGTCAAACCCA
GAGAGGCCATCGTGGAGCTCATAGTGCAATATCCTCCTGC
GGTGGAGCCGGTGTATACAGAGATCAGGCAGGGTCTTGGT
CGGCCGTTCTCTCTGAGCTGCAGGGTCTTGCGTGCCCATC
CGTCAAGAGTACTAAAGTATGAATGGAAGTTGGGCACCAG
ACTGCTAACAATGGGCCAGTTTGATACTCGGGATGAAACA
GAGTACCATGTAAGGGCTCTCAACCGTGAGGGCTATGGCG
CGTACACTTGTGACATCACCAACGAAGCAGGGGCTGGTCG
ATGTACTTTTCTTGTCACAGGTAAAGCATTTGCTCCTGAG
TTCTTTTATGATACCTACAGCGCACTGTGGCAAAACAAAC
CTCGTGTCTACGGCTTCAAACTCCAGTGGACTCAGATGAA
TCCCAATGCGGTCGACCGTATCATGGCTTATCGACTTGGT
ATCAAGCAGATGGGGCATCAGAGATGGTGGGAGCAGGAGA
TCCCTACAGAGGACAACATCCAGAAAGGAGAGCTGCTCAG
CTACAACCTCACCGAACTCATCAAACCTGAGGCCTATCAG
GTGCGCCTCACACCCATAACACGCTTCGGAGAGGGCGATT
CCACAGAACGCATCATCCGCTACAGTGCACCAGTGAATCC
TCATTGGAGTAAGTTTCACTGCGGGTTTGAAGAGGACACC
ATCTGTATGTTCACCCAAGATAAAACTGAAGAGTTTGATT
GGACAAGACACAGCGCTGCCACCAGGGACACTAAATATAC
ACCCAACACTGGACCCAGCAGCGACCGCTCTGGCTCCAAA
CAAGGTTTCTACATGTACATTGAGACCTCTCGGCCACGTC
TGGAGGGAGACAAGGCTCGTCTGTTGACCCCATCTTTCAA
TGTTGCTCCAAAAAATCCCTACGGAAATGTGGCCAGCAAC
CCAACATACTGCTTCAGCTTCTACTACCACATGTACGGGA
AACATATAGGAACGTTAAATGTGTATTTGAGGCAGAAGAG
TCAGACAGGTCAGGATACATCAGTGTGGACCCTGAGTGGA
AACCAAGGAGACCGATGGAGGCAAGCCAGAGTCAACATCA
ACCCCACATCCTCTTTCCAGATTGTTATGGAGGGAATACG
TGGTTCTGGCATTGAAGGGGACATTGCAGTAGATGATGTG
ACTATAGAAGAAGGAGAGTGTCGAGATCCTCCACCCAGTA
GTAATATAAGATCCCTGGCTTCTCCCACTGAAGTGCATAT
ATGGCAGCTCGCTCTCACTTTACTTTTGGTCTTGGTCGGC
CTCCGCAGGTGACCTCATCACACCGAGGTGGAACCAGCTT
CGGCATTCATAGGGATTTTGGCTGACTCGGACTGCCTGAA
CACTACAACCAAAGATTCATCCCGTCGACACAAAAGGAAC
GTAGGTTTTAGATCAGTGCGAACGAAGAGGAAGCCAGGGA
GGGAATCTAAAGCTCACCAACACATTGACATGGGTATTAC
ACTGGAGTCCACTCAAAATCTCCAAGAAATGCCCATTACC
GCTGTCAGTGTTATAAAGAACAGAACAGGTGGATGGTTCC
AGCAGGACGGCTTGAGAGACTTAATAGGGGAATCTTTCAA
AGCACAAAGACATAACATGTATTTCCATTGCTACATGGGT
TTTTGCTTTGTTAAAGTTCATCAGAGACCTCATTATGTCA
CAATACGTAATACTGAACCACACGAAGAAAGAAAAAAATC
AAGAAAACCTGTGATGGTAACAAAAAAAAGAATGATAAAT
GTTTTTTGTTTGTTTGTTTTTTTTAAATATGTCTGAAAAT
ACAGGTATGTCAAATACA

mdga2a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mdga2a-201 4138
mdga2a-202 (1)    Ensembl 585
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mdga2a-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000055559 (1),  Ensembl_Trans:ENSDART00000033943 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EV559233 (1) 613 nt
GenBank:CR928593 (1) 539 nt
GenBank:BI979700 (1) 515 nt
CITATIONS (2)