ZFIN ID: ZDB-TSCRIPT-131113-3891
Transcript Name: fmn2a-201
Previous Names: fmn2a-001, dkey-97l21.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055387 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055387|OTTDARG00000038639|ZDB-GENE-101107-1 fmn2a|OTTDARP00000043438 DKEY-97L21.3-001 LG_ CT027692.7 Danio rerio protein_coding PUTATIVE, 4941 bp
AGGCCACAATAGCAGGAATCAAGATGCAGACCATTCAGAC
AATTGAGATGCAGTTACCTGTCCTTCGAGAGAGTTTCCAC
TCCTCTCCCTTCAGAGAGAGAGCAAAAGAGCGCAGGAAGA
GCAGCCTGTCAAATCTCATCAGAAGACAACAGCAACAGTT
ATTACGTGAGCAACAGCAGTCAGTATTACATCAGAAACAA
CAGCCATCCTCGCCCTTACAAGGCCACACTGCACATGCTC
AGTTGGTCCGCTCTTCCAGCAGCCCATTATGTGACCTGGC
GGAGCAAATAGGCGAGCTAGAGAAAGTGAGAGGCATTGGG
AGGCAGGGGGAGCTGTCTCACAGACAGTCCTCAGATACAG
CGTCACAGCCAGCATCATCACAGCAGCTGCTGCTGGCGGT
GAAGAGAGAGAGAGAGGGATTACTGAGGGAGGGGGAGAAA
GTGCAAGGGAGCACTGAGAGGGAGAGAGAGGAGAAGAGAG
AACGAGAAAGTCAATCTGAGCGCACACGTTCCCAGCATGG
CCTGATCGCTAAAGGTGTTCGCCTTCTGAGGATCATGGGA
AACCAGGAGGCAAAACAGAAGAAGCCCACTGTCACGACAG
GAGCAGAAGGTGAGGGGAACGGAGCAGGCACTGAGGACCA
TGTCAAAAAGATTAAGAAAAGTAAATCATCTGCCGAATCA
GGCAAGAAGAAATCCAAATCGGAGGGTTCCAAAGGTTCTG
TGTTTTCCAACATCCGCATCCGTAAGGGCCTCTCCCGGAA
AGTGTTGTCCAAAGAGGATGTACTGGATGGTGGGATTAGG
ATTAAGCCTGCTGATGCAAATGGCAACAGTAATGGTGGAA
TATCTGGTGATGAGAGTTGCATGCCTGACTCTAAGCAACT
CACGGCTGAAAGTAGGCAGTCGACTCTGGACACCACTGAA
GATGATGTTGAAAGAGAGACTGAGGGATCGGGGTCAGATA
CAGACCTCTGCAGCTATCATTCAGCTGCCGAGGCTCAAGA
TCTGCTGTCGGACATCCAGAGAACCATCAGACAGATGGAG
GGAGTTGATGAGAGGCAAAACTGTCACTCTGAGGACAAGG
AGAGACAAGTCGGGTTCGAAGGCCATGTTGAAGTCACTCA
CGGTCCTACAAGAGGTAGTCTTGCTTGTGAGGGTGAACCG
GAAAAGTTAGAAGGTGCTTCTGACAGCAAATATCTCAATC
TGATATGTAGTGGGGATACAACAGGAGGGGTGATCACATC
AAAATTAAAGATAGAATCAGATGGGAAAGTTGCTGATATT
CCAAATAAAGCTGACCACTTGTCCAGTTTGTCTAGTGACT
ACAGTATTCAGGATGCTGTACCAGAGACAAATAGTGTCCA
GGATGCAAGAGCTTTTACTCATTCAACAAGTAACTACAGT
TTTCAGGACAATACAGGAACATCCACTTCTTACGAGAGTG
CTGAAGAGATCTTGGAGAGTTCATCTTTATCTTCTCCTCT
TGAAGAGTGTCATTATGATAGCAATAGTCTGACTCAGAGC
CTTGAAGTTGGTCTGAATTCGAGCAATCACATGTCCAAAA
TCAACCGGGTCATTTTTGTTCCACAGAAGAGCATTAGTAG
TGTAGAGCTGAACGTAGATGGTGATGGTCCAGTAGAAGAG
GTAGACAGGGGTTTTTCCACCCAACCAAGAAGGAAAAGCA
GTGCTGCATCTATGACACAGTGGTCATCGGAGAACTTTTT
AGGCTCTGGGTCGCGACCTCGTAGAACCTCCAGTGCAAAC
CTTGGGGTTAAACCTTATCCCACAATACAGACTTCTTATG
TTAAAACAACCACCAGACAGCTCACCTCACCCATAATATC
TCCATTCACTACTCCTTCACCAAGCCCTATGTGTCCTCGC
AAGGTTGGCTTAGAGTTTGGAACAGGTCAAGGGCCGTACC
GAGCCGGAAGCTGGAGAGCACGAAGGCAGCGATCCTGTAG
CATTGCAGGTCCAGTGGGCTGCCATGAGGAATGGTGTGAG
GTCATACATGATCAGTCTGAACTTATAGAGAGTGGCTTCC
AGACTGATAGATCCAGGCAAACAACATCCACTTTTCCAGA
TGTGTTTTCAGGTAGCTCTCTATTGGAGAGGTGTTTCTTA
CAGTGGAGCTCATCTGAAGATGACAGTGCTATGCAGGACA
TCGAGAGATTCTGTTCTCGTATTCTGGATCTGGGGATTTT
ACAGCCCTTCAGTGACTGCATCAGGGAGCCATCCACAGGA
AGTGACGTCACAGATAAGCCCACTTTCAGTAAGGATCAAC
TGTACACCTGGGCTCCAATGGGTCAGCATGACATCAGAAC
ACCTGGGCGGTTGCAAAGAATTTGGCCTCCGACCCTTACT
GCTGCACAGGATGGATCCACGGGGCAATCTGGAAGTGTTC
TGGAAGGGTCTTCCGTTTCCATTCAGGAGCTAGAGCAAAC
AATTGAAGAGTTACTTGAGAAAATATCAGAAATAGAAAAA
GATAATCATGTTGTGGATGGAAAACTTGGAAGGAAGGATC
GAGAAGTGGCTGGTTTTAATCAAACCATCAAACAGACTAA
AGTAAACGGACAACGTGTTCTGCATCATGTAAAAGCCATT
CAGACCTCGCCTGTTGAGGAAGCCTTCAAATTTCCAGTGC
CTTTATCACACCAATCACAGACTCCCAAATTAAGTGACAG
TGCCACTTCACCAATGGGATTACCCTATACCTGTAGCTGC
CAAAGAACCACTTCTCAACCACTATCAACACCACCACCCC
CTCAACTCCCTCCTCCCCCACCACTTCCAGGTATGACTCT
ACCAAAACCCACAGGTGTGATCCCACCTCCACCTCCTCTG
CCAGGTTTTGTTCCGCCACCTCCAGTTGTTGGCAAAGCTC
CACCCCCTCCTCCACTCCCAGGCATGGTCCCACCTCCTCC
ACCTCCACTTCCAGGTATGGCCCCACCTCCTCCACCTCCA
CTCCCAGGCATGACGCCACCCCCTCCTCCCCCTCCTCCTG
GCTGTGGACCTCCAGCGCCCCCTCTTCCACCTGGAATTGG
ACCTCCACCACCCTTCATGGGTATGGGGCCTCCAGGCATG
GCCCATGAGTCTGTCCCCCTGAAGGCTGTCATTGAGCCTC
CACGACCAATGAAACCACTCTACTGGACCCGGATTCAGCT
TCATGCCAAAAAGGATGCCAAAAGTGCTTTGGTGTGGGAG
AATGTTCAAGAGCCATCAGTAGACTTTGACGAATTTGTGG
AAATGTTTGCCAAAAGTGCAGTCAAGGAAAAGAAGAAACC
TATCTCAGATACAATAACCAAATCGAAGGCCAAACAGGTA
GTCAAGCTTCTGAGTAACAAACGTTCTCAAGCGGTGGGGA
TTCTGATGTCCAGTCTTCATTTAGATATGAAAGACATTCA
GAATGCCATCTTGAACATGGACTGCACAGTGGTGGATCTG
GAGACGCTCCAGGCTCTGTATGAAAACAGAGCTCAGAAAG
AGGAGATGGACCAGATCGAGAAACATGTCAAGTCTTCCAA
AGACAAAGAAAAACCAAAACCACTGGACAAGCCTGAACAG
TTTCTGCTGCAGCTGTCAGAGGTTCCTCAGTTCTCAGGGC
GGGTTTTTTGTATTCTCTTCCAGTCCACCTTCACAGAGTG
TGTTACATCAGTTCAGCGCAAGCTAGAAACCCTTGGGAGA
GTCTGTACGGCTCTACAATCAGGCCAAGCTGTCCTGCAGA
TCCTAGGTTTGGTTCTAGCTTTTGGGAACATCATGAATGG
GGGCAACCGGAGCAGAGGACAGGCAGACGGATTTTCCCTT
GACATCTTGCCCAAATTAAAAGATGTCAAGAGCAGTGATA
ATTCTCAGAGCCTCCTGTCCTACATAGTTGCTTACTATCT
GCGACACTTTGATGAGGATGCAGGTAAAGAAACGTGCACG
TATCCACTTCCAGAACCTCAGGATCTATTTCAGGCATCGC
AGATGAAGTTTGAAGATTTTCAACGTGACCTCCGCAAGCT
ACGGAAAGATCTAAATGCCTGTTCAGCAGAAAGAGAAAAG
GTGTGTAATATCTCATCTGATGAGCACCTGCAGCCCTTTA
AGGACAAAATGGATGATTTTCTAACTAAAGCCAAAACAGA
GCTGGAGCTCCAGGAAAAACAGCTCACTGACACGCAGAGG
ATTTTTCTGGAGCTGAGCGTGTTTTTCTCGGTCAAGCCTA
AGGCGGGAGAGAAAGAGGTTTCACCGAACACATTCTTCAC
AGTGTGGCATGAGTTTTCATCAGATTTCAAGGAGCTGTGG
AAGAGAGAGAATAAAAGCCTCCTGCAGGAGCGGTTGAAAG
CTGCAGAAGAGACTTTCAAACAAGCACGAGAGAAGGCTAC
CTACAACGTTAAACCTAAACAAGCATCAGGAATCAAAGCT
AAGCTGGGCCAGAAGATGTGAAATTCTGCTAAACCGAATC
CCTCAAGACTCGTTTATGTGTCTGTTTGTTCTTTCTTTTT
TTTAAATAATAAGTTACTTCAGCGTAAACTTAATAGCCGT
GAGATTAAATGTTTAATGTTATTGTATGATTGGAATACAT
TTGTCATTTCTGTATTTTTTAATATTGACAATCCAAGCTT
GAAGTGCCCATAAAGTTCAGAAACTTTACCTGTTTGGTAA
CACTTTATTTCAAGGGGCATTGATAAGACTGACGTGACAC
CTTTATAATTATCACATGTATATAACACAAGTATGGAGTT
TTTATGCAAGCTTATGACAACTGTAATTAGGTGTCATTAG
TTAGATTAGGTGTTTTTAAATGCAAAGATGACATTGTTTG
AGATGTCTTTGTTATGACAACTTGACATTATCAAGACAAC
ATGTCAAAAATCTGTCATAAACATGATTGCCATGAGGTCC
TTATAATCATTCATTCATCCATTTTCTTTTTAGCTTAGTC
CCTTTGTTAATCAGGGTGGCT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fmn2a-201 Contained in:
[BAC] DKEY-97L21 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000055387 (1),  Ensembl_Trans:ENSDART00000154745 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CK714292 (1) 863 nt
GenBank:CK694293 (1) 684 nt
GenBank:CN019531 (1) 610 nt
GenBank:CR927472 (1) 539 nt
CITATIONS (2)