ZFIN ID: ZDB-TSCRIPT-131113-3866
Transcript Name: lrfn5a-201
Previous Names: lrfn5a-001, ch73-206h2.1-001, si:ch73-206h2.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000055297 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000055297|OTTDARG00000038591|ZDB-GENE-080327-17 lrfn5a|OTTDARP00000043376 CH73-206H2.1-001 LG_ CU928225.5 Danio rerio protein_coding KNOWN, 2361 bp
ATGGAAAAACTGCTCGTCTGCTTGTTGGTTATCGGAATGG
CAGTGAAGGCCCAGATCTGTCCAAAGCGCTGCGTCTGTCA
GGTTCTTTCCCCCAACCTCGCAACACTCTGTGCCAAAAAA
GGGCTGCTCTTCGTCCCCCCTAACATCGACAGGCACACCG
TGGAGCTCCGGCTAGCTGATAATTTTGTCACCAGCGTCAA
ACGGAAAGACTTGGCCAACATGACCAAGCTGGTGGATCTT
ACGTTATCCAGGAATACAATAAGCTACATCACTCCACATG
CATTCGCAGACCTGGAAAACCTACGAGCCTTGCATCTAGA
CCACAACCGCTTGACGCGAATAGCCAACGACACTTTCAGT
GGCATGTCCAAGCTGCATCATCTAATCCTGAACAACAACC
AACTGACCCTCATCCACATGGGAGCCTTTAATGACCTACT
AGCCCTCGAAGAGCTGGATTTATCCTACAACAACCTCGAG
ACCATCCCCTGGGAGGCCATTCAAAGGATGACCAGCCTAC
ACACTCTCAGTCTGGACCACAATATGATTGAATACATTCC
TGAGGGGACGTTCTCCCTCCTACAGAAGCTCAATCGCTTG
GACGTGACCTCCAACAAGCTCCAGAAGCTCCCACCGGACC
CTCTTTTCCAACGAGCACAGGTTCTGGCAACATCCGGCAT
TATGAATCCCTCTTCTTTTGCGCTAAGCTTCGGAGGCAAT
CCTTTACATTGCAACTGCGAGCTACTGTGGCTTCGGCGGC
TCAATCGCGAGGACGACTTGGAGACCTGCGCCACACCTTT
GCACCTCTCTGGACGCTATTTCTGGTCCATCCCCGAGGAG
GAGTTCCTCTGTGAGCCGCCCCTCATTACCAGGCACTCTC
ACGAAATGAGGGTTCTGGAGGGCCAACGAGTGGCATTAAA
GTGCAAAGCCAGGGGAGATCCCGAACCTGCCATACATTGG
ATATCTCCCGAGGGAAAGTTAGTCTCGAACACGTCACGCA
CGCTGGTTTACAACAACGGCACGCTGGACATCCTGATAAG
CACAGTAAAAGACACAGGCTCTTTCACCTGCATCTCCTCC
AATCCTGCAGGGGAGGCTCATCAGACCATAGAGCTGGTCA
TCATTAAGCTTCCACACATCAGCAACAGCACAAATAACAT
CCAGGAGCCGGACCCGGGCTCTTCTGATATCTCCACTTCT
ACAAGGGCAGGAGCAAACGGTGGCAACCACACCGGTGACA
CCAAGACCAGCTCCGATAAGAGAGTGGTTATGGCAGAAGC
CACTTCCTCCACGGCACTCATCAAGTTCAACTTTCAGAGG
AATATACCTGGAATACGCATGTTTCAGATTCAGTACAATG
GAACCTACGATGACTCTCTTGTTTACAGAATGATTCCCCC
AACGAGTAAAAACTTCCTTGTGAATAACCTGGCGGCCGGG
ACACAGTACGACCTTTGTGTGCTGGCCATTTATGATGATG
GCATGACCTCCCTGACGGCCACGCGGGTTGTGGGCTGCGT
CCAGTTCACCACAGAGTCTGAATATCTGCGCTGCCACTTC
ATGCAGTCCCAGTTCTTAGGCGGCACTATGATCATCATCA
TCGGTGGCATAATCGTGGCCTCCGTCCTCGTCTTCATCAT
CATCCTCATGATCCGCTATAAAGTGTGCAACAGCGGCGAC
GCAGCAAAGGGAACGTCAGTCATCGATGTGCACTCACAAA
CCAACGGTGCGCAAGGATGTACCGTCACTCCGTCTGCATC
CAAACAAGGTGCTTTGAGCTTGGAGGAGGGTGAGGGGGGC
AAAAAGAGCTCCGCCGCACCTCTTCCTCCACCTCCGGATT
CCCAAACGCACACCTCAGAGACCTCCATCCCAGACTGCTC
CACCTCCACCTCCACGGTAAGTCAAAGCTGGGCGACTCCC
GGCTCTTCAGGGTCACTAAAGCCAAAGCGCAAACCAGCGC
CAAAGCCCGTCCCGACAGCTGAGCAGCCCAAAGCAGAAGT
GCTGCCCAATGCAGAGACGCAAAATACCAATCGCAACAAC
TCCACCGCCCTTTACCAACCTGCCCCACTCCCTCCACCCC
CGTCCCGCTTCAAAGACACCCCCATTTTAAGAAGGGCGCG
TCCGTCTACGTCCAAGTATATGACTCTGCCCGTTGAAGGA
GCGTGGGCCAAACGCAGGTACTCTTTGAACGAGAACCTGT
CAAAACATCACTGCTACATTGGCTCGCAGAAGCTGGGAAA
TGTGTTTTGCAAGCGGAGTATGTCCATGAACGGAATGCTT
GTCCAAATGGCAAACTCTAATCTAGACAGTGAAAAAGCGG
CATTTTCCAGTTCCGAGTGGATTCTTGAGAGCACAGTGTG
A

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lrfn5a-201 Contained in:
OTHER lrfn5a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000055297 (1)
  • Ensembl_Trans:ENSDART00000105175 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CU468768 (1) 1584bp
    CITATIONS (2)