Transcript

kif28-201

ID
ZDB-TSCRIPT-131113-3859
Name
kif28-201
Previous Names
  • rp71-84d9.2-002
  • si:rp71-84d9.2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055276 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055276|OTTDARG00000038578|ZDB-GENE-130530-1027 si:rp71-84d9.2|OTTDARP00000043361 RP71-84D9.2-002 LG_ BX649415.10 Danio rerio protein_coding PUTATIVE, 924 bp
AATATGGATGGAATGAAGATGACTCAAGAGGACAGCGTTA
TTATTGACAAGATCAGTGCATCAGAACACTTGACTGCAGA
AACAGGCAGCTCTGACCTCAGCTCATCTCTCCGAGCCCTT
CATCAGGACTTGGATAAGCTGAGAAATGCAAACGCCGCAC
TGAAGAAAGAAAACAGCGCTTTGAGAGAGCAACTCAACTC
ATCCAGAAATGGTGTGGAGAATAACCGCGGTCGACAGGAA
CGCAGAGGCAGTCTGAGGCCCAGCTGTGATGCTGAGTTTG
CAAAAGCCTTAAAGGTTTTCTACCACAGCATGACCTCTGT
TAGGGGGCAACTTCAACGCCTGCGAAGGCACAAACCCAGT
GAGGAAGAAGACCTGTTGGGTCTCAGGCTGTTTGTGGATG
AACATACCTTTCTCCTGAAGGACTTTTCTGAACAGTTGGA
ACAGTGCGTCTCCACTCTCAAACATGATGTGGCTGCAATT
GTCCGTCGAAAGCGAGAAAAGTCTGGAGTTTGGTCCTGAA
ACACCTATTAAATCAATCATCCTGCATTATTTACAAGACT
GAAACTTTGCGATCAAAATACTACATTTATACAGCCTTAA
GAGCGCATTTGTAACTGGACACTACTTTACTAATTTTGAA
ATGACTAAGTGAATTGAATGTGTTGTATATTACTGGATCT
ACAGAATAAGACTTGTTCATTAACCAGAATACTCTTAACT
GATCATATTTCTCAACATGCAAACACCCAGAGTGCGCTTG
ATCGTTCATTTCTGTTTTGAAAATGAACTAAGGATGTAAT
ATTAAGCATTTACTTTATTCATTGTCAAACTTTTTTCAGT
TCTGGACTTGATTTGATATTCACTGATTTAAATTTGTACA
GTTTTTCTCAAGAAATACAATGTGGGAAATAATGCTGGAA
ACTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations