Transcript

kif28-202

ID
ZDB-TSCRIPT-131113-3858
Name
kif28-202
Previous Names
  • rp71-84d9.2-001
  • si:rp71-84d9.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055272 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055272|OTTDARG00000038578|ZDB-GENE-130530-1027 si:rp71-84d9.2|OTTDARP00000043357 RP71-84D9.2-001 LG_ BX649415.10 Danio rerio protein_coding PUTATIVE, 1913 bp
GCATTCAGGAGAAGCATGCTGTGTTTTCCAACCAGCAGAG
GAGAGTCTCCATTACTCCTGTGTCTGGAGCCAAGGTCATT
GTAAACGGACTGCAAGTATCTAAAAGGACAGAGCTGCAGC
ATTTGGATCGACTTGTCCTGGGTTCGAACAGCACATATCT
CTTCATTGGCTTCCCTTCAGAGCGTTCGGCAGAGGACTGG
AGCCGCTATGACTATGATTACTTCCAGTCTGAGCTGGCAG
CTGCCGAGGGTTTCCACATCCAGTCTCTGTGTGATGATCA
GGGCCACCGGCCGCACCAGCCGGACCCCAGTCTACTAGCT
GTGTTTTATGACTATATCAAGCTGATGCCCATGGTGACAG
AAGCCAATCAAATGAGTGCAGAGTTAAAGAAGGGAGTTGA
ATTCAAATTGGAAATCAAGAATCTGGCGATGTCGGACTCT
AAAGGTCATGACCTAGAGAAGGACATCGCTGTGAAAGTGA
CGTCTGTAGAGAGCAAACAGGTGTGGATGTGGTCCAAAGC
TAAATTTATCAACCGCAAGTTTCTGATGGAGGAAGTGTAC
CAGCAGCAGGTGGCAGGAGGAGAGGGTGCAGACCGAGCTC
CACTTCCCAGAGACAGAGACCCGTTCTGGGACCCTCTGGA
GCCTCTGCACCTGGGCAGTGCTCACCTGTGGCTGCAGTCG
CTGGCGTTTCGCATCCCTCTGGAGGAGCAGGTGGAAATGG
TGGGTCCGGAGGGAACAGAGGAGGCCATACTGCAGGCGCA
GCTTGTGCCCTGCAGCCCCGCAGGATTAGCTCTTGGTGAA
GATGACATCTTAATTGACCCTTCAGAGCTGCTTGGCAAAC
GGCTGGACTTTCAGCTGGTTTTGGATCAGTGCTGTGGATT
ACGCTGGGTTAAAGAGGCTCGGAACAGAGGCGTGCAAATA
GGGTTTCAGGTGTTTGACTGTCCGCAGCCGCTCTACACTC
CAGCAGTTTGGCACAATGTGAATCCGCTGTTGGATCATAG
AGTCCAGTTCACTGCTCTGAGAACCTCTCAGGATCTGCTC
AACTATCTGCAGAGCAATGCCCTGGTGCTGGAGCTCTGGG
GCCTGCAGGAAGGATGCTCTGAATTGCTCTCTAATATGGA
TGGAATGAAGATGACTCAAGAGGACAGCGTTATTATTGAC
AAGATCAGTGCATCAGAACACTTGACTGCAGAAACAGGCA
GCTCTGACCTCAGCTCATCTCTCCGAGCCCTTCATCAGGA
CTTGGATAAGCTGAGAAATGCAAACGCCGCACTGAAGAAA
GAAAACAGCGCTTTGAGAGAGCAACTCAACTCATCCAGAA
ATGGAGGAAGAAGACCTGTTGGGTCTCAGGCTGTTTGTGG
ATGAACATACCTTTCTCCTGAAGGACTTTTCTGAACAGTT
GGAACAGTGCGTCTCCACTCTCAAACATGATGTGGCTGCA
ATTGTCCGTCGAAAGCGAGAAAAGTCTGGAGTTTGGTCCT
GAAACACCTATTAAATCAATCATCCTGCATTATTTACAAG
ACTGAAACTTTGCGATCAAAATACTACATTTATACAGCCT
TAAGAGCGCATTTGTAACTGGACACTACTTTACTAATTTT
GAAATGACTAAGTGAATTGAATGTGTTGTATATTACTGGA
TCTACAGAATAAGACTTGTTCATTAACCAGAATACTCTTA
ACTGATCATATTTCTCAACATGCAAACACCCAGAGTGCGC
TTGATCGTTCATTTCTGTTTTGAAAATGAACTAAGGATGT
AATATTAAGCATTTACTTTATTCATTGTCAAACTTTTTTC
AGTTCTGGACTTGATTTGATATTCACTGATTTAAATTTGT
ACAGTTTTTCTCAAGAAATACAATGTGGGAAATAATGCTG
GAAACTATATGAAGCTCTGTCAGTTGGTATCTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations