Transcript

grm2a-202

ID
ZDB-TSCRIPT-131113-3797
Name
grm2a-202
Previous Names
  • grm2a-001
  • dkeyp-111e5.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055049 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055049|OTTDARG00000038424|ZDB-GENE-030131-8097 grm2a|OTTDARP00000043172 DKEYP-111E5.5-001 LG_ BX664752.20 Danio rerio protein_coding NOVEL, 2560 bp
TTCAGGTGGCCAATCTCCTACGCCTTTTCCAGATCCCTCA
GATCAGTTATGCCTCCACCAGTGCAAAACTGAGTGACAAA
TCCCGCTATGATTACTTTGCCCGGACTGTACCTCCTGACT
TCTACCAAGCCAAAGCCATGGCTGAGATCCTACGCTTCTT
CAACTGGACGTACGTCTCCACTGTGGCCTCAGAGGGAGAT
TACGGCGAGACGGGCATCGACGCCTTTCAGCAAGAAGCTC
GGGCCTTACAAATCTGCATTGCAACATCTGCCAAAGTCAG
TCGCTCCATGGACCAATACAGTTATGATGGAGTGATCAGA
TCTCTGTTGCAGAAGTCCAACGCTAAAGTGGTAATCCTGT
TCACCAGAAGTGAAGATGCAAGAGAGTTGTTGGTCGCTGC
GAAGCGAATGAATGTCTCCTTCATCTGGGTGGCCAGTGAT
GGATGGGGAGCGCAGGAGGTTGTGGTGAGAGGGAGTGAAA
GTGTTGCGGATGGAGCTTTTACTATTGAGCTTGCGTCATA
TACCATCCCTGAATTCGCAGCGTACTTTACAAACCTCAAT
CCGTATAACAACACACGTAACCCGTGGTTCAGAGAGTTCT
GGGAGAACAAATTCCAGTGCAGTCTGCATGATATTACCTG
TGGGAAACATTCTCTTCGGGATGGTAAATTCGAGCAGGAG
TCTAAAATCATGTTTGTGGTGAATGCAGTGTATGCTATGG
CCAATGCGCTTCACCACATGAGGCAGGCATTGTGCGCCAA
TAGCACCAAACTTTGCAGTGCCATGAAACCTGTGAACGGG
AAAAGGCTGTATAAGGACTACATCCTGAAGACAAAGTTTG
ATGCTCCATTTCGCCCGGCCGATACTGATAACATCATTCA
CTTTGATGCATACGGAGACAGTTTGGGCCGCTACAACATC
TTCCATTATCACAAAGAGAATGATGAGTACGTCTATAGAA
AGGTGGGCTACTGGGCTCAGGATTTGACTCTGAACACAAC
CTTAATTCCTTGGGAGAGCCAAGCGGTGCCCACATCCCAG
TGCAGCGACCCATGTAGGAAAAACGAAATTAAAAGCATGC
AGCCCGGAGATGTTTGCTGCTGGATTTGCATTCCCTGTCA
GCCCTACCAATACCTCCTGGATGAATTCACATGTGCGGAT
TGTAGCTTCGGACAGTGGCCTCTAGACAATCTCACAGGCT
GTTATGACTTACCTGAGGAGTACATTCATTGGGAGGATGC
CTGGGCAATTGGACCTGTCTCTATTGCTTGCCTCGGCATG
CTTTGCACGCTCTTCGTCATTGGCCTCTTCCTGAAAAACA
ACGAGACTCCGGTGGTGAAGGCTAGTGGACGGGAACTTTC
CTATATTCTTCTCCTAGGCGTCCTTCTTTGCTATTTCATG
ACTTTCATCTACATCAGCAAACCTTCAGCCGTTGTGTGCA
CGTTACGACGGCTCGGTCTGGGCACGTCCTTCGCCGTTTG
CTACTCTGCATTACTCACCAAGACCAATCGCATTGCTCGG
ATTTTCAACGGTGTTAAAGATGGAGCTCAAAGGCCGAGGT
TCATCAGTCCAGCCTCACAGGTGGCCATCTGCGCTGCTCT
TATCTCCTGTCAGCTTCTTGTGGTAGTGGTCTGGCTCCTG
GTCGAGGCTCCGGGGGTGAGAAAGGAGGTCAGTCCTGAAA
GAAGAGACGTGGTGACATTGAAGTGCAACAGCAAGGACTC
GAGCATGCTGATGTCCTTAACCTACAACTGTGTCCTCATC
ATCCTCTGTACCTTTTATGCCTTTAAGACTCGAAAGTGCC
CAGAGAACTTCAACGAAGCCAAGTTCATCGGCTTCACCAT
GTACACCACATGTATAATCTGGCTGGCTTTCCAGCCCATC
TTCTATGTTACTGCCAGTGACTATAGGGTACAGACCACAA
CCATGTGCATCTCTGTGAGTCTGAGCGGTTCGGTGGTTCT
GGGCTGCCTCTTCGCTCCCAAAATCCACATCATCCTCTTT
CAGCCGCAAAAGAACGTCACCACACTCAGAGTGGCCACCA
CGCGCTTTAGTGTGACCACCGGCCCCGGCTCCAGCTTCTC
TCAAGCCTCGGCCTCCAACATTGTGCCTACAGTATGTAAT
GGCAGAGAGGTAGTGGACTCAACAACATCTTCACTCTGAG
AAACAGGATTCCTGTTTGTTTGCCAAATGCGATTTACTGA
TAAATCCTATCTTCACTAGTCATGAAATCAAGTGTTTGCT
AATGTTGAGAAGGCTATTCTGGATAAAGAATAAAGCCTGT
TATGTTGTTCTCAACGTGCTGTGAGTACAATATCCCATTT
GTTTCTCTTTCTCTTACTCTTTCTCTATCTGACTAGTTAG
ATCATATCAGTGGGATGCCAGTTTAAACTCTGTATACCCA
TTCTTTTTATGGAAACCATAATAAAGTATTGTTTGAGATA
TGGAGTTAAAATATAGTAAATCTGTTTAAAGTATTATATA
CGAGATGTTTTTAATGTAGATTTCTGGTGATTCTGGTTTG
TGCTTTCTTGTAATTTATGTAAATAAAATGTGTTTTTTAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations