Transcript

selk-004

ID
ZDB-TSCRIPT-131113-367
Name
selk-004
Previous Names
  • ch1073-219o6.1-004
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000052623 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052623|OTTDARG00000036934|ZDB-GENE-040912-131 selk|no_translation CH1073-219O6.1-004 LG_ CU855933.8 Danio rerio protein_coding KNOWN, 703 bp
CCGTTGTTGTGTGTTCAGGTCAGGTTCTGGACAGCAGGAG
CCGTTCGCCCTGGAGTCTGTCCTTCCTGACCGACTTCTTC
TGGGGTGCAGTCGAGTTCATCGGCCTGTTCTTCCAGACTC
TGGTCCAGCCGGATCTGTCTAAAGATGGAAACAACAGCGC
ATCGTCTCGCTTCAGTGACGGCAGAGGTCCTCCTGGGTTC
CCAGGCCGCCGACGGATGGGTAGAATAAACCACGGTGCAG
GTCCCACACCTCCACCCATGGGCGGAGGAGGATGAGGAAG
GTAAACGCCTGCACGCTGATGCAGGCGCTGAGGACAGAGA
GACGCTGCTGAGAGTCTGTGATGAACATTAATGCAGACGC
TCTACAGATCTCCACCGTCCTCTCCATCGGCTGCTGCTGC
TGCTTTACCGCACACTCATGACGTTACTCTGGGAATTCCT
GCACCGAGGGGCCAGAGTCACTGATCATGGCAGCCACACA
CACACACACACACACATACATACATACATACACATACATA
CTCACACACACTCACATACATACACATACATACATACACA
TATGCTTACATACTCACACACTTGTTTCATAACTCTTCTT
GGTTTTTATTCAGTAATGTCTTATATTAAAAGGAGCTGTT
GTGATGGATATTCTATGTGCAATTGGCATCAATAAAGTAA
GTTATGTTGAATTCTGTCCACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations