Transcript

selenok-204

ID
ZDB-TSCRIPT-131113-366
Name
selenok-204
Previous Names
  • selk-001
  • ch1073-219o6.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000052620 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052620|OTTDARG00000036934|ZDB-GENE-040912-131 selk|OTTDARP00000041362 CH1073-219O6.1-001 LG_ CU855933.8 Danio rerio protein_coding KNOWN, 740 bp
GAAGTGGAGAGAGGATCCGGTTAAACAGCAGTGACGATGG
TTTATGTGTCAAATGGTCAGGTTCTGGACAGCAGGAGCCG
TTCGCCCTGGAGTCTGTCCTTCCTGACCGACTTCTTCTGG
GGTGCAGTCGAGTTCATCGGCCTGTTCTTCCAGACTCTGG
TCCAGCCGGATCTGTCTAAAGATGGAAACAACAGCGCATC
GTCTCGCTTCAGTGACGGCAGAGGTCCTCCTGGGTTCCCA
GGCCGCCGACGGATGGGTAGAATAAACCACGGTGCAGGTC
CCACACCTCCACCCATGGGCGGAGGAGGATGAGGAAGGTA
AACGCCTGCACGCTGATGCAGGCGCTGAGGACAGAGAGAC
GCTGCTGAGAGTCTGTGATGAACATTAATGCAGACGCTCT
ACAGATCTCCACCGTCCTCTCCATCGGCTGCTGCTGCTGC
TTTACCGCACACTCATGACGTTACTCTGGGAATTCCTGCA
CCGAGGGGCCAGAGTCACTGATCATGGCAGCCACACACAC
ACACACACACACATACATACATACATACACATACATACTC
ACACACACTCACATACATACACATACATACATACACATAT
GCTTACATACTCACACACTTGTTTCATAACTCTTCTTGGT
TTTTATTCAGTAATGTCTTATATTAAAAGGAGCTGTTGTG
ATGGATATTCTATGTGCAATTGGCATCAATAAAGTAAGTT
ATGTTGAATTCTGTCCACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations