Transcript

actr8-202

ID
ZDB-TSCRIPT-131113-3554
Name
actr8-202
Previous Names
  • actr8-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052625 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052625|OTTDARG00000036935|ZDB-GENE-030131-5065 actr8|OTTDARP00000041364 actr8-001 LG_ CU855933.8 Danio rerio protein_coding KNOWN, 2240 bp
GAGCAACCACTCAACCGACGTAAACAAGTAGAAGAAGTCA
GTTTCTGATTCACCAGCAGAGTGTTGATGAATGTTCAGTT
GATTTAATTAGTTTCTTATCATCATAACCATGACACAAAC
AGATCGAGATGCGGAGAACGGCCGGGACAGAGAGAAAGAC
CGGGAAAAAGAGCAGCAGCGCGGCGTGAAGAGACCCATCA
TGCCCGCCGCGGTACCGGAGCCCGTGCAGGAGCAAATTCA
AGCCAACTTCATCGTTGTGATTCATCCTGGATCAAGAACG
CTGCGTCTGGGTCGAGCGACGGACACATTACCCATAAGCG
TCCCTCATGTGATCGCCCGCAGACACAAACACCCCGGCCA
GAGCCGCTATGAAGACAAGTGTCTGCTCCGAGAAGGCCTG
AATTCTGCAGACAGTAATGAGCAGAGGCAGAACGGGCTGA
AAATGGTTGATCAGGTGATCTGGTCCAAGAAAATGTCCAA
CGGTGTGAGGAGAACGCCAGTGTCCGCAGAACAGGCAAGG
TTATACAACAGACAGATACGACCTGCTGTTCTAGACCCAA
ACTCTAAAGTCAGCTGGACAAACACAAGTCACCATCCTGA
ATATGTGGTCGGAGAAGAGGCGTTGTATGTGAACCCTACA
GACTGCTACAGCGTGCACTGGCCCGTGTGCAGGGGTCGTC
TGAACCTCCACAGCGGCTCCGGCGGCTCGCTCAGTGCTGT
CATGATGGACCTGGAGCACATCTGGACTCACGCTCTTCAG
AAACTCCTACAGATCCCTCTGAAGGATCTCAAGTATTACA
GATGCATCCTCCTCATTCCTGACATATATAACCGTCAGCA
TGTGAAGGAGATCGTCAATATGCTGCTGGTTAAAATGGGT
TTCTCAGCTGTTGTGGTGCACCAGGAGTCAGTGTGTGCCA
CCTTCGGCAGCGGTCTGAGCAGTGCGTGTGTTGTGGACGT
GGGCGATCAGAAGACCAGTGTGTGCTGTGTGGAGGACGGC
GTCTCCCACCGCAGCTCCAGGTTGTGTCTTGCGTACGGGG
GCTCAGACGTGACGCGCTGCTTCTTCTGGCTCATGCAGAG
AGCTGGGTTTCCCTATAGAGATTGTCAGCTGGGGAATAAA
CTGGACTGTGTGCTTCTGCAGCAGCTCAAAGAGTCCTTCT
GCCACCTGGATCAGGATATTTCCGGACTGCAGGATCACGA
GTTCCGCACCCGTTTCCCAGATTCCCCAGTCCTGCTGTAT
CAGCTGCGGTTAGGAGACGAGAAGCTCCAGGCTCCGATGA
CGTTATTCTACCCGGCTGCGTTCGGGATTGTGGGTCAGAA
GATGACATCACTGCTGCATCGCTCTCAGGGAGACGCGGAG
GATCCTCACGACGAACACTTTCTGCTGACCACACAGAGCA
AACAAGACCAGTCGTCTAAAGCCAGCGCAGATCGTAAATC
CTTCCCCAAACCGAGCAGTTTCGAAGGTGAATCCAGCGTT
TGCGAGGTGTCAGACAGGAGCAGTCTGGGTCAGGATCTGG
ATCTGGGTCATTCTCAGGCCGAGTGTCTGGTCGGAGGAGC
TGAAACTGAAGAGACGCCGTCTGCTCTGCTGTCCAGGAAA
ACAGCCATGTCTCAGTTTGAGGGAAAAGCTCTGGGCATCG
ATAAAGCCATCCTGCACAGCATCGACTCCTGTGCGTCGGA
CGAGACGAAGCGTAAGATGTACAGCTGTATTCTGGTGGTC
GGCGGCGGGCTGCTGTTTCACGGAGCGCAGGAGTTCCTGC
AGCATCGCATCCTCAACAAGATGCCGCCTTCGTTTAGATG
CATGGTGGAGAGCGTAGACGTCATCACACGACCCAAGGAC
ACGGACGCTCGAGTGTGTGTGTGGAAGGGAGGCTCGGTGC
TGGCGTGTTTGGACACCACACAGGAGCTCTGGATCCACCA
GCGCGAGTGGCAGCGCTTCGGTGTGCGGATGCTGAGAGAG
AGAGCCGCCTTCGTCTGGTAAAACACTGAAATCTGGTCAT
GATGCTAGTGACCTGGACATATTGTGTACATATGTTTATT
TGCATTTTCCTTCAAGCGTTTTGATTCATATAAAAGTGAT
TAAAGATGTAAAAGATACTTGCACTTAAAATGTTTTACTT
ACTTTTGTTTTATAAGTGTATGTACACACAGCAGTTCTGG
TCGTGGAATCTGATTGGCTGAACAGTCATGATGTAAACAT
TGCACGTTTTTGAAAACATGCAATAAAACTGTGAGCAGTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations