Transcript

actr8-201

ID
ZDB-TSCRIPT-131113-1952
Name
actr8-201
Previous Names
  • actr8-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052624 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052624|OTTDARG00000036935|ZDB-GENE-030131-5065 actr8|OTTDARP00000041363 actr8-002 LG_ CU855933.8 Danio rerio protein_coding KNOWN, 443 bp
CCTGACAACCCTGTCTCCAGGCCAGCAGATGGCGGGAAAG
CGAGCAACCACTCAACCGACGTAAACAAGTAGAAGAAATC
GAGATGCGGAGAACGGCCGGGACAGAGAGAAAGACCGGGA
AAAAGAGCAGCAGCGCGGCGTGAAGAGACCCATCATGCCC
GCCGCGGTACCGGAGCCCGTGCAGGAGCAAATTCAAGCCA
ACTTCATCGTTGTGATTCATCCTGGATCAAGAACGCTGCG
TCTGGGTCGAGCGACGGACACATTACCCATAAGCGTCCCT
CATGTGATCGCCCGCAGACACAAACACCCCGGCCAGAGCC
GCTATGAAGACAAGTGTCTGCTCCGAGAAGGCCTGAATTC
TGCAGACAGTAATGAGCAGAGGCAGAACGGGCTGAAAATG
GTTGATCAGGTGATCTGGTCCAAGAAAATGTCCAACGGTG
TGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations