ZFIN ID: ZDB-TSCRIPT-131113-1952
Transcript Name: actr8-201
Previous Name: actr8-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000052624 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000052624|OTTDARG00000036935|ZDB-GENE-030131-5065 actr8|OTTDARP00000041363 actr8-002 LG_ CU855933.8 Danio rerio protein_coding KNOWN, 443 bp
CCTGACAACCCTGTCTCCAGGCCAGCAGATGGCGGGAAAG
CGAGCAACCACTCAACCGACGTAAACAAGTAGAAGAAATC
GAGATGCGGAGAACGGCCGGGACAGAGAGAAAGACCGGGA
AAAAGAGCAGCAGCGCGGCGTGAAGAGACCCATCATGCCC
GCCGCGGTACCGGAGCCCGTGCAGGAGCAAATTCAAGCCA
ACTTCATCGTTGTGATTCATCCTGGATCAAGAACGCTGCG
TCTGGGTCGAGCGACGGACACATTACCCATAAGCGTCCCT
CATGTGATCGCCCGCAGACACAAACACCCCGGCCAGAGCC
GCTATGAAGACAAGTGTCTGCTCCGAGAAGGCCTGAATTC
TGCAGACAGTAATGAGCAGAGGCAGAACGGGCTGAAAATG
GTTGATCAGGTGATCTGGTCCAAGAAAATGTCCAACGGTG
TGA

actr8 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA actr8-201 443
actr8-202 (1)    Ensembl 2240
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
actr8-201 Contained in:
[Fosmid] CH1073-219O6 (1)

Genome Resources: Vega_Trans:OTTDART00000052624 (1),  Ensembl_Trans:ENSDART00000157521 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB924075 (1) 443 nt
CITATIONS (2)