Transcript

washc5-201

ID
ZDB-TSCRIPT-131113-352
Name
washc5-201
Previous Names
  • strumpellin-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052505 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052505|OTTDARG00000036859|ZDB-GENE-040426-838 strumpellin|OTTDARP00000047726 strumpellin-001 LG_none CR848685.7,FQ311929.2 Danio rerio protein_coding KNOWN, 3228 bp
CAGTGTGAGGCTCTGTATCTGTATGGAGTCATGTTACTGG
TTATCGATCAGAAGATGGAAGGAGAAGTAAGAGAAAGGAT
GCTGGTGTCCTATTATAGATACAGCGCTGCTCGCTCCTCA
GCTGACTCTAACCTAGATGACATCTGCAAGCTTTTGCGTA
GCACAGGATACTCCAGCCACCCGGGGGCTAAACGGCCAAC
AAACTACCCTGAGAGCTACTTCCAGAGAGTTCCCATCAGC
TCCACATTCATCAGTATGGTGATTGGCCGCTTGCGCTCTG
ACGACATCTACAACCAGGTCTCTGCGTATCCTCTGCCGGA
GCACCGCAGCACAGCTCTGGCGACTCAGGCCGCTATGCTT
TATGTCTGCTTATATTTCACTCCCTCCATCCTGCACACAC
AACAGGCCAAGATGAGAGAGATCGTGGACAAATACTTCCC
TGACAACTGGGTTATAAGCATATACATGGGCATCACAGTG
AACTTGGTGGAGGCGTGGGAACCATATAAAGCTGCTAAAA
TAGCCCTGAACTACACGCTGGACACAGCTAACATCAGAGA
ACAGGCTGGACGATACGCTGCCAGTGTGGAGACTCTGCGG
CCGCAGGTGCAGCAGTTGTTGAAGGAGGGATTCCTGAGGG
AAGAAATCATCCTGGACAATATTCCCAAACTGCTCAACTG
CCTCCGAGACTGTAATGTTGCCATCCGCTGGCTGATGCTG
CACACTGCAGAGTCCGCTTATGATCCAAACAACAAGAGGC
TTCGTCAGATCAAAGACCAAGTCATCAACGACTCCAAATA
CAACCCCAAAATTCTGTTTCAGCTGCTGCTGGACACGGCT
CAGTTTGAGTTCATACTCAAAGAGATGTTCAAGCAGATGT
TGGCAGAGAAGCAGCTGAAGTGGGAGAGCTATAAGAAGGA
GGGATCAGAGAGGATGATGGAGCTGGCCGAGGTGTTTTCA
GGGGTCAAACCTCTTACCAGAGTGGAGAAAAATGAGAATC
TTCAGGCCTGGTTCAGAGAAATCTCCAAACAGATCGAGTC
CCTGAACTATGAAGACTCCACGGCTGCCGGCAGGAAGACT
GTACAGCTCATTCAGGCTCTGGTGGAGGTCCAAGAGTTTC
ACCAGCTGGAGTCCAACCTGCAGGTGTGTCAGTTCCTGGC
GGACACCCGCAAGTTCCTGCATCAGATGATCCGCACCATC
AATATTAAAGAGGAAGTGCTCATCACCATGCAGATAGTGG
GGGATTTGTCCTACGCCTGGCAGATCATTGACAGCTTCAC
CGCAATAATGCAAGAGAGCATCAGAGCAAACCCATCAATG
GTGACCAAGCTCAGAGCCACTTTTTTAAAGCTGGCGTCTG
CACTGGATCTGCCTCTGCTGCGAATCAACCAGGTCAACAG
TCCCGACCTTCTGAGCGTCTCTCAGTTTTACTCCGGGGAG
CTGGTGGCATACGTTAGAAAGGTGCTGCAGATCATTCCAG
AGAGTATGTTCACCTCACTGGCCAAAATCATCAAGCTGCA
GATTCATGACATTATGGAGGTGCCCACACGCTTGGACAAA
GACAAACTCAAGGATTACTCTCAGCTCAGTGCCCGCTATG
AGGTAGCTAAACTCACTCATGCCATCTCCGTCTTCACCGA
AGGTATCCTGATGATGAAGACCACACTTGTTGGGATCATT
CAGGTGGATCCCAAGCAGCTTCTGGAGGACGGGATCAGGA
AAGAGCTTGTCAAACGTGTAGCGTACGCTTTGCATAAAGG
CCTCATCTTCAACCCTAAAGCCAAACCCAGTGAACTGATG
CCAAAGCTGAAGGAAATGGCTGCCACTATGGATGGGTTTT
ATCGCTCGTTTGAGTACATTCAGGATTACGTGAGCATCTA
CGGCCTGAAGATCTGGCAGGAGGAAGTATCTCGAATAATC
AACTACAACGTAGAGCAGGAGTGCAACAGTTTCCTTAGGA
CAAAGATCCAAGATTGGCAAAGCGTCCACCAGTCCACCCA
CATTCCCATTCCTAAATATCCATCAGTTGATGAATCCGCC
ACATTTATTGGACGTCTTTGCAGGGAAATCCTGAGGATCA
CAGACCCCAAGGTGACGTGTTACATTGACCAGCTCAACAC
CTGGTATGATCTGAGAACGCATCAGGAAGTGACAAACAAC
CGGCTGTTTTCTGAGATTCAGGACACGCTGGGAACGTTCG
GGCTGAACGGACTGGACAGACTCCTGTGCTTTATGATCGT
CAAAGAGCTGCAGAATTTCCTGACAGTTCTTCAGAAGAGC
ATCCTGAAGGATAAAGCTGTGGTAGACGTCTTCAAAGCTC
TGCTGACCGCTGTCAATCCTGTCAAAGGAATTGTGGCAAA
TGCAAGCAAAGTCTACACAAATGCTGCGGCCAAAACACAG
AAGATCTGGAGCCCGTATCTGGAATCCATCATGAAGGTGG
GTCAGATGCAGATCTTGAGGCAGCAGATTGCCAACGAGCT
CAATTACTCCTGCAAATTTGACTCCAAACATCTCGCTGCA
GCGCTGGACAACCTCAACAAGTCCCTGCTGTCCGATATTG
AAGCTCATTACCAGGATCCATCACTGCCGTATCCTAAAGA
AGACAACACTCTTCTGTATGAGATCACTGCCTACCTGGAG
GCTGCAGGAATACACAATCCGCTCAACAAGATCTACATCA
CAACCAAGCGTCTGCCTTATTTCCCTATCGTCAACTTCCT
CTTCCTCATCGCGCAGCTGCCAAAACTGCAGTACAATAAA
AGCCAAGGAATGGCGTGCAGAAAGCCTGCAGATGCGCTGG
ATTGGGCTCCTCTGGTTCTGGGTCTGCTGACGCTCCTCAA
ACAGTTTCACTCCAGATACACGGAGCAGTTCCTCGCTCTG
ATTGGACAGTTTATTCGCTCCATAATGGAGCAGTGCACCA
GTCAGAAGATTCCAGACATGCCTTCAGATGTAGTCGGAGC
GTTAATGTTTCTGGAGGACTATGTGCGTTACACTAAACTG
CCAAGAAAGGTGGCAGAGGCTCACGTGCCTAGCTTCATTT
TTGATGAATTCAGGACTGTGCTGTAAATCTCATAATGACG
AGATCTTCTCTCTTTCTCTTAAAGCACTAATGACGTTGAG
CGATTCGCATTTTTAACATTTCACTTTTAAAACATGATCA
TGTTTTGTAGCTGTTACTGACCTCATGTCTGTCTGCTAAG
CTAATAAATGCTAATCTATGTTTTGAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations