ZFIN ID: ZDB-TSCRIPT-131113-3504
Transcript Name: si:ch73-329n5.6-003
Previous Name: ch73-329n5.6-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051871 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051871|OTTDARG00000036434|ZDB-GENE-131121-171 si:ch73-329n5.6|OTTDARP00000040757 CH73-329N5.6-003 LG_ CU914622.9 Danio rerio protein_coding PUTATIVE, 616 bp
ATTGTTGTAATAAATGGTATACAAAAACAACTGAGGCAAT
CAGGATAAGACCTTTTATATTTTGGATTTATTTCTGACTG
CATCATCATGTTTCTGATTTCATCGCATCTGCTGTTGTTC
TTATCACTCCTGGCTCAATCCAGAGCACAAACAACAATAG
ACACTACAGAAATCACCACTGAAATCCTCACGACCACAAC
CCCAGAGACCACCACTGAAATCCCCACAACCACAGCCACA
GAAACCACCACTACAAACCCAGAGACCACCACCGAAATCA
CCAATACAACCCCAGATACCACCACTGAAACCACCACTGT
AGACACCACTACAATTCCAGTAACCACCACAACCCCGGAG
ACCACCACAGAAACCACTACAGAAGAGACCACCACCACTA
CCACCCCAGAAACCACTACAGAAGAGACCACCACCACCAC
CCCAGAAACCACTACAGAAGAGACCACCACCACCACCCCA
GAAACCACTACAGAAGAGACCACCACCACCACCCCAGAAA
CCACTACAGAAGAGACCACCACCACCCCAGAAACCACTAC
AGAAGACACCACCACCACTGAGAGCACCACCATTGCATCA
ACTACTGCATGGACAG

si:ch73-329n5.6 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:ch73-329n5.6-002 (1) 885
si:ch73-329n5.6-003 616
si:ch73-329n5.6-203 (1)    Ensembl 1894
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-329n5.6-003 Contained in:
[BAC] CH73-329N5 (1)

Genome Resources: Vega_Trans:OTTDART00000051871 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CF995938 (1) 780 nt
CITATIONS (1)