ZFIN ID: ZDB-TSCRIPT-131113-1903
Transcript Name: si:ch73-329n5.6-203
Previous Names: ch73-329n5.6-001, si:ch73-329n5.6-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051870 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051870|OTTDARG00000036434|ZDB-GENE-131121-171 si:ch73-329n5.6|OTTDARP00000040756 CH73-329N5.6-001 LG_ CU914622.9 Danio rerio protein_coding PUTATIVE, 1894 bp
GGGTGTGTGACAGATGATGAGTCACTATAAATCACTCAGC
AAACAGAACTGTGGTCATAACATTGTGCTGGATTATGGTT
TCATTTGGATACACTGAAGTGATCCAACAAGACATTCTCT
TTTGCGCCAGTAGATGTTGTGCTGGGACATAAAAATCAGT
GAAACTTCCTCTTAAACTACAGCAGGTGAAAGAGCAGCTG
AGAAGAAAGGATAAGACCTTTTATATTTTGGATTTATTTC
TGACTGCATCATCATGTTTCTGATTTCATCGCATCTGCTG
TTGTTCTTATCACTCCTGGCTCAATCCAGAGCACAAACAA
CAATAGACACTACAGAAATCACCACTGAAATCCTCACGAC
CACAACCCCAGAGACCACCACTGAAATCCCCACAACCACA
GCCACAGAAACCACCACTACAAACCCAGAGACCACCACCG
AAATCACCAATACAACCCCAGATACCACCACTGAAACCAC
CACTGTAGACACCACTACAATTCCAGTAACCACCACAACC
CCGGAGACCACCACAGAAACCACTACAGAAGAGACCACCA
CCACTACCACCCCAGAAACCACTACAGAAGAGACCACCAC
CACCACCCCAGAAACCACTACAGAAGAGACCACCACCACC
ACCCCAGAAACCACTACAGAAGAGACCACCACCACCACCC
CAGAAACCACTACAGAAGAGACCACCACCACCCCAGAAAC
CACTACAGAAGACACCACCACCACTGAGAGCACCACCATT
GCATCAACTACTGCATGGACAGCCCCGGCAATATTCTACC
CATTCGGCTCAGCAGCAGGAGACACTGGATATACTGAAGT
TGGCTATGAGTCCTATCAATATGTGACCTTCTCTACTCCA
TTTACATTCTTTACCCGCAATTACAGCAGCATTTATGTCA
ATAATAATGGACTCCTTACGTTCAACCAACCTTTACCAGA
AGCTAACCCTGTACCCTTTCCCTCAAATGGAAATGAAGAT
TACATTGCTGCGCTCTGGACCGAGCTTGATGACATGGGTT
ATGGCAATTACTGGTTTCATGAGTACATAAATGGAAGTGT
GCTCGACCGGGCCACTAAGGATATAAACCAATATTTCCCA
GATAGGGGCTTCGCTGCTTCTTGGGTCTTTGTTGTCACAT
GGGACTACGTGTTTACAACAGATTTTTATACACTTAATAA
TCACTTAGGACAGGCAATTACGTTTCAAGCAGTTTTAATT
TCCGGAGGTGGTTTTTCTTTTATTCTATTGAATTACGGTG
ACTGTGCTGGTACATATTTTCCAGTGGAGGCTGGATATGA
TACCATTGGCTCCACTGACTACCATGTCATCCTTTATGGA
AATCCTGGCTACTCCATCTCAAACCTCAAGAACACGACTA
ATGTAAATCTTCCTGGTCGTTGGGCTTTTCTTGTGAACAA
CGGGACAGAAAACGTCATAGGACTTCAAATGAAACTTAGG
TCATATTTAGACCTAACACAGACTCAAAGCATGGAGGGTG
TGTTGCAGCTAATAAAAAAGGAGCTGGTCAGTCAAGGAAT
GTCAAGTTCAGTTGGGCTGAAAATAAGAAAAGTCCAAAGG
ACATGGCCGTGATACAAGAAAAGGATATAAAACTCCTTTG
AAAGTTGTTTTTTATTAAAGATGTATGGACCGAAATTGAG
GGAAATGTCACTACACAACAGCAAAATTGCTTTATATTCT
CAACCTTCTCAAAAATGATCAACACACAAGTATAAATGAG
TATGAAATGAATCCTCTTCATTGATCCTCTTTTTTCTACT
ATCAAATACTGTGAACGAATACAAGTTTCAGGGAAGTGAA
CAAATCAACCTGTATAATATGAGAACAATGTAATTAAACC
TGTTCTTCACCCCA

si:ch73-329n5.6 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:ch73-329n5.6-002 (1) 885
si:ch73-329n5.6-003 (1) 616
si:ch73-329n5.6-203 1894
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch73-329n5.6-203 Contained in:
[BAC] CH73-329N5 (1)

Genome Resources: Vega_Trans:OTTDART00000051870 (1),  Ensembl_Trans:ENSDART00000170045 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EE706233 (1) 948 bp
GenBank:CN019137 (1) 937 bp
GenBank:CK127542 (1) 834 bp
GenBank:CF998568 (1) 781 bp
GenBank:EB764015 (1) 692 bp
GenBank:BQ131862 (1) 586 bp
GenBank:EB904714 (1) 554 bp
GenBank:EB798731 (1) 531 bp
CITATIONS (2)