Transcript

si:ch73-329n5.6-203

ID
ZDB-TSCRIPT-131113-1903
Name
si:ch73-329n5.6-203
Previous Names
  • ch73-329n5.6-001
  • si:ch73-329n5.6-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051870 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051870|OTTDARG00000036434|ZDB-GENE-131121-171 si:ch73-329n5.6|OTTDARP00000040756 CH73-329N5.6-001 LG_ CU914622.9 Danio rerio protein_coding PUTATIVE, 1894 bp
GGGTGTGTGACAGATGATGAGTCACTATAAATCACTCAGC
AAACAGAACTGTGGTCATAACATTGTGCTGGATTATGGTT
TCATTTGGATACACTGAAGTGATCCAACAAGACATTCTCT
TTTGCGCCAGTAGATGTTGTGCTGGGACATAAAAATCAGT
GAAACTTCCTCTTAAACTACAGCAGGTGAAAGAGCAGCTG
AGAAGAAAGGATAAGACCTTTTATATTTTGGATTTATTTC
TGACTGCATCATCATGTTTCTGATTTCATCGCATCTGCTG
TTGTTCTTATCACTCCTGGCTCAATCCAGAGCACAAACAA
CAATAGACACTACAGAAATCACCACTGAAATCCTCACGAC
CACAACCCCAGAGACCACCACTGAAATCCCCACAACCACA
GCCACAGAAACCACCACTACAAACCCAGAGACCACCACCG
AAATCACCAATACAACCCCAGATACCACCACTGAAACCAC
CACTGTAGACACCACTACAATTCCAGTAACCACCACAACC
CCGGAGACCACCACAGAAACCACTACAGAAGAGACCACCA
CCACTACCACCCCAGAAACCACTACAGAAGAGACCACCAC
CACCACCCCAGAAACCACTACAGAAGAGACCACCACCACC
ACCCCAGAAACCACTACAGAAGAGACCACCACCACCACCC
CAGAAACCACTACAGAAGAGACCACCACCACCCCAGAAAC
CACTACAGAAGACACCACCACCACTGAGAGCACCACCATT
GCATCAACTACTGCATGGACAGCCCCGGCAATATTCTACC
CATTCGGCTCAGCAGCAGGAGACACTGGATATACTGAAGT
TGGCTATGAGTCCTATCAATATGTGACCTTCTCTACTCCA
TTTACATTCTTTACCCGCAATTACAGCAGCATTTATGTCA
ATAATAATGGACTCCTTACGTTCAACCAACCTTTACCAGA
AGCTAACCCTGTACCCTTTCCCTCAAATGGAAATGAAGAT
TACATTGCTGCGCTCTGGACCGAGCTTGATGACATGGGTT
ATGGCAATTACTGGTTTCATGAGTACATAAATGGAAGTGT
GCTCGACCGGGCCACTAAGGATATAAACCAATATTTCCCA
GATAGGGGCTTCGCTGCTTCTTGGGTCTTTGTTGTCACAT
GGGACTACGTGTTTACAACAGATTTTTATACACTTAATAA
TCACTTAGGACAGGCAATTACGTTTCAAGCAGTTTTAATT
TCCGGAGGTGGTTTTTCTTTTATTCTATTGAATTACGGTG
ACTGTGCTGGTACATATTTTCCAGTGGAGGCTGGATATGA
TACCATTGGCTCCACTGACTACCATGTCATCCTTTATGGA
AATCCTGGCTACTCCATCTCAAACCTCAAGAACACGACTA
ATGTAAATCTTCCTGGTCGTTGGGCTTTTCTTGTGAACAA
CGGGACAGAAAACGTCATAGGACTTCAAATGAAACTTAGG
TCATATTTAGACCTAACACAGACTCAAAGCATGGAGGGTG
TGTTGCAGCTAATAAAAAAGGAGCTGGTCAGTCAAGGAAT
GTCAAGTTCAGTTGGGCTGAAAATAAGAAAAGTCCAAAGG
ACATGGCCGTGATACAAGAAAAGGATATAAAACTCCTTTG
AAAGTTGTTTTTTATTAAAGATGTATGGACCGAAATTGAG
GGAAATGTCACTACACAACAGCAAAATTGCTTTATATTCT
CAACCTTCTCAAAAATGATCAACACACAAGTATAAATGAG
TATGAAATGAATCCTCTTCATTGATCCTCTTTTTTCTACT
ATCAAATACTGTGAACGAATACAAGTTTCAGGGAAGTGAA
CAAATCAACCTGTATAATATGAGAACAATGTAATTAAACC
TGTTCTTCACCCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations