ZFIN ID: ZDB-TSCRIPT-131113-3416
Transcript Name: cul3a-201
Previous Name: cul3a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000050193 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000050193|OTTDARG00000035288|ZDB-GENE-030131-3376 cul3a|OTTDARP00000039399 CH211-253N2.1-001 LG_ CU570974.6 Danio rerio protein_coding KNOWN, 2958 bp
CAGTCGTCCGCCATCGCTGTAGAGACAGAGGGAAAGAGTA
AGCTACAGGGACTCAAACCTGGGGGGGAAAGAGGGCGAGA
TTTGTCCGTGTTTCCCCTCAAAACACCCACCCTAACATTT
GTTGATGGCATCGCTCCCTAACCCAAACATGTCCAACCTC
AAACCCGGCACGAAGAAGGACACCAAGATGCGGATCCGCG
CCTTCCCCATGACCATGGATGAGAAGTATGTGAATAACAT
ATGGGATCTTCTGAAGAACGCCATCCAGGAGATCCAGCGA
AAGAATAACAGTGGGCTGAGCTTCGAGGAGCTCTACAGGA
ACGCCTACACCATGGTTCTGCACAAACATGGGGAGAAGCT
CTACACGGGACTGCGAGAGGTGGTCACCGAACACCTCATC
AACAAAGTTCGAGAAGACGTGCTTCACTCGTTAAATAACA
ATTTCCTGCAGACTTTAAATCAAGCGTGGAATGATCATCA
GACTGCCATGGTCATGATTCGAGACATCTTGATGTACATG
GACCGTGTGTACGTCCAGCAGAATAATGTGGAGAACGTCT
ACAATCTGGGTTTGATCATCTTCAGAGATCAGGTTGTGCG
GTATGGCTGCATCAGAGATCATCTCCGACAGACTCTGCTG
GACATGATCGCTCGAGAGCGCAGAGGAGAGGTGGTCGACA
GGGGAGCCATCAGGAATGCCTGTCAGATGCTGATGGTTTT
GGGCTTAGAAGGTCGCTCCGTCTACGAAGAGGATTTTGAA
ATCCCGTTCTTAGACATGTCTGCTGAGTTCTTCCAGATGG
AAAGCCAAAAGTTCCTAGCAGAAAACAGTGCCAGTGTCTA
CATCAAGAAAGTAGAGGCTCGGATAAACGAAGAGATTGAG
CGAGTGATGCACTGTCTGGATAAATCGACAGAGGAGCCCA
TCGTGAAGGTGGTGGAGAGAGAGCTCATCTCCAAACACAT
GAAGACCATCGTGGAGATGGAGAACTCTGGACTGGTCCAC
ATGCTCAAGAATGGAAAAACAGAAGACCTGGCGTGCATGT
ATAAGTTATTTGGTCGAGTTCCTAATGGTCTGAAGACAAT
GTGTGAGTGCATGAGCTGGTACCTCAGAGAGCAGGGGAAA
GCACTTGTTTCAGAGGAAGGAGAGGGGAAAAACCCTGTCG
ACTACATTCAGGGTTTGTTGGACTTAAAGTCTCGCTTCGA
CCGGTTTCTTCAGGAGTCTTTTAACAATGACAGGCTCTTT
AAACAAACTATCGCTGGAGACTTTGAGTATTTCCTCAATC
TTAACTCCAGATCGCCAGAGTATCTCTCACTTTTCATAGA
CGACAAGCTTAAGAAAGGAGTGAAGGGGCTGACAGAGCAA
GAGGTGGAGTCCATCCTGGATAAGGCCATGGTTCTGTTCA
GGTTCATGCAGGAGAAGGATGTGTTCGAACGTTACTACAA
ACAGCATCTGGCCAGAAGGCTTTTAACCAATAAGAGCGTT
TCAGATGACTCTGAGAAAAATATGATCTCCAAACTAAAGA
CCGAGTGCGGTTGTCAGTTCACCTCTAAGCTGGAGGGCAT
GTTTAGAGACATGAGCATTTCTAATACAACTATGGATGAA
TTCCGCCACCATCTGCAGACATCACAGGTGTCTCTGTGTG
GTGTTGATCTCACAGTGAGAGTTCTAACCACTGGTTACTG
GCCCACACAGTCGGCCACTCCTAAATGCAACATCCCACCC
TCCCCACGTCATGCATTTGAGGTCTTCAGAAGGTTTTATT
TGGCCAAGCACAGCGGCAGGCAACTCACACTCCAGCACCA
CATGGGTTCAGCAGATCTCAATGCCACCTTCTACGGCCCC
ATCAAGAAGGAGGACGGTTCAGATGTTGGTGTCGGTGGTG
CTTTGTTAACAGGCTCAAACACACGGAAGCACATTCTGCA
GGTGTCGACCTTCCAGATGACCATCCTCATGCTCTTCAAC
AACAGAGAGAAGTTCACATTTGAGGAGATCCAGCAGGAGA
CTGATATCCCCGAGCGTGAGCTGGTCAGGGCCCTGCAGTC
TTTGGCCTGCGGAAAACCCACACAGAGAGTGCTCACGAAA
GAGCCCAAGAGTAAAGAGATCGAGAGCGGCCACGTGTTTA
CAGTCAACGACCAGTTTACCTCCAAACTGCACAGAGTCAA
AATACAAACAGTTGCTGCTAAGCAAGGCGAGTCAGACCCC
GAGCGTAAAGAGACGCGGCAGAAAGTAGACGACGACAGGA
AGCATGAAATTGAAGCTGCCATCGTCCGCATTATGAAGTC
CAGGAAGAAGATGCAGCACAACGTACTGGTAGCGGAGGTG
ACCCAGCAGCTGAGGGCACGTTTCTTGCCGAGCCCCGTGG
TTATTAAAAAGCGCATTGAAGGACTAATAGAAAGAGAGTA
TTTGGCCCGGACGCCGGAGGATCGTAAAGTGTACACGTAT
GTGGCATAGTGGAACACATGTCTGCACAAAGAGACAAGGA
GCGAGCAACATAAAGACAAGAAAAATTACAAAAAAAAAAG
ATTCTGGACTGCTCTTCGCATGGACTGACTGGGAAGTTTC
TTTTAACTAAAGATGAACTCTGGGTAGCGGACTTCACTTA
AAAACAAAAAGCAAACCGAGAAATCGTAAAGCATTCGATC
GGGGAAAATAATCAGGAGGCAAAATAAGAAATCCATAATT
GTGTTGTAGATTTTTTTTAATTAGATCACTCCCACTCTTA
TGAAAAACCTCAGCTTATGAATGGATCCAGCTTTCAGTCT
TCTCACCGTTTTACCCTTGTAGAGATCAAAACGAAAAAGA
ATCCCTTGGGAAAATGTGAATGCACTGCACATGTTGTTGT
TGTTTTTTTTTCAATACTGTATAAAAGGCAAAATTATTAA
AAACCCTAACAAAACAGCCAAAACGTGGCTACGGAAATAA
GGCGGAAAACGTTCAATAAAAAATGTTGATATTGAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cul3a-201 Contained in:
OTHER cul3a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000050193 (1)
  • Ensembl_Trans:ENSDART00000056882 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AY423034 (1) 2979bp
    GenBank:BC065357 (1) 2936bp
    GenBank:BC060901 (1) 2920bp
    GenBank:EH487773 (1) 931bp
    CITATIONS (2)