Transcript

mrtfaa-201

ID
ZDB-TSCRIPT-131113-3395
Name
mrtfaa-201
Previous Names
  • mkl1a-001
  • dkey-68o6.10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000049915 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000049915|OTTDARG00000035119|ZDB-GENE-121205-3 mkl1a|OTTDARP00000039170 DKEY-68O6.10-001 LG_none BX569789.4,CT573460.6 Danio rerio protein_coding NOVEL, 4584 bp
ATGGAGGCCATGGAGGAGGAGTCAAAGCCCATTGTCCCCA
CCCCTGCTGTTTCCACAGCCTCTGCCTCCAGCCCACAAAG
TGAAGCTGTAACCAATGAACTGCAAGATTTGTCTCTTCAG
CCCGCCCCCAATTTGCCTCCTATTTACGAGAGGAAGAATG
CTGAGCAGCATGCTGGAAACCAGCTCGTGGCTTTACACTG
GCCCCGCCTCTTTTGGATCTGCTCCAATCAGCCATGGCAT
GAAGAAGCAAGCTCTTCGATTGGACCAAGAGCGACGGGCC
TGCCTGAGTTTGAGACGAGAAACAGGAAGAGGAAGCATGT
TGTAGTTTGTACTCTCTTCTCTGTGACTGATAAACTCACT
ACCGGCTGTCAGAAAGGGCTTGTTTGTGGGGAGAATGAAC
GAGACGGATCGAGCTGCTCGCCGGTGCTCCAACTCAAACT
TCAGCAGAGGCGAACTCGAGAAGAACTGGTTGACCAGGGG
ATCATGCCACCACTGAAAAGTTCAGCGTCTTTTCATGAGC
AGAGACGAAGTTTAGAACGAGCACGAACTGAGGACTACCT
AAAGAGAAAGATCCGCAGTCGTCCAGAGAGGTCAGAGCTG
GTCAGGATGCACATTCTCGAAGAAACTTCAGCTGAACCAT
CTCTTCAGGCCAAGCAGCTGCTGCTGAAACGAGCTCGTCT
AGCAGACGACTTGAACGATAAAATCTCTCAGCGGCCCGGG
CCCATGGAGCTTGTTCACAAAAACATCCTTCCTGTTCACA
GCAGCATCAAACAAGCCATCATAGAGACTGAGTTTCCAAA
AGTAGAAGCGGAGAATTCTTCGTTTGATGAGGAAAGCAGT
GATGCATTTTCACCGGAGCAGACAGCCATTCAGGACTCTC
CCCTTGGTCACACCCACTTACCTACTTCCGCTGAGTTACC
AGCGAATGAAGCCACACCAAAACAGGTCCCGCCTCCTCCT
CCGCCTGCACTGCCAAGCCCCACCCCTCAGCAGAAACTTC
TCAATGGAACAACAGGCCAAAAGCAAGCTCCTGCACTACA
GAAGAGTGGTAAAGTGAGTAGTGAGCGTCCTGCTCAGCGC
TCTAAGAAAGTGAGAGACAATAAACCTAAAGTCAAGAAGC
TGAAATATCACCAGTATGTTCCTCCGGATCAGAAAGCTGA
GCGTGAGCCTCCGCCTCTGCTCGACTCGTCCTACGCTAAA
CTCCTCTACCAACAGCAGCTCTTCCTCCAGCTACAGATTA
TCAACCAACAGCAGCAAAACTACAACTACCACACCATCCT
GCCAGCTCCACCCAAGCCTCCAGCTGATCAGCAGCCTGCT
TTAGCCAATGGCCAGTCACAGTCCAAGAATGACACTCCCC
CTCAATCAACATCCACTAATCTGACTAGTCAGAACCAACA
GTCCACTATAAATGTAGGCAGAGTTAACATAAGCCCACTG
CCTCCCAACCTGGAGGAGCTAAAGGTGGCAGAGCTGAAGC
AGGAGTTGAAACTGCGAGGCTTGACAGTCTCGGGCACAAA
GAATGACCTTATTGAGCGGCTGAGGAATTTTCAGGAGCAG
AACGGTGGGACCAGCCCGCCAACACCTAAAACCAACACAC
CCTCAGCCCTAGGGGGAGGAGCCTCTTCCACACACCAATC
AACAGACAGGAACCTGATGGTTGCTTCCTTCCAGTTCGGT
GCCACTGCAGAAGGAGGGGGAACTCTGACAACAGCGCCAA
TGATGATGCAGTTTGGCAGCACTAGCTCCTCCCCTCCGGT
TTCCCCTGCCCACTCCGAGCGTTCATCCACTGGAATGAGT
CCAGATGAGGCGAGCTGTCATGCAGATGCTTTCGGGGAAA
TGGTGAGCTCTCCTCTCACCCAGCTCTCCCTGCAGCCGTC
TCCTCCTCTCCCGACCACTGTGTGCATTAAAGAAGAGCCC
TGTAGCCAAACATATCAATCCTCCTCCTGCATGCTTTCTC
GTTCTGCAGACAAGGACCAGATGCTGCTGGAGAAGGACCG
GCGCATTCAGGAGCTCACCAACATGCTTTTGCAGAAGCAG
CAGCTAGTTGAGTCCCTGCGTCTGCAGCTGGAGGGGAAAC
GGGTGCAAGAGCCCAATCCAGTCAAAGAGGCGCTTCCTGC
TGCCGTAATTGAGGCTCTTAGAGTCACTGTAAAGGAGGAG
GTGATGGAGGTGGTGGAAGACAGTGAGATGGTGACGGAGC
CGCAGGTGGAGCTGGAGCAGCAGCAGAGGATTGTAATGCG
ACAGAATCAACGCAACCTGCTGCAACAGACACATCAGAGG
AAGAGGAAAACACAGAAGCAGCAGAGACAATTTCCTCAAG
CACTTACCAACCAGCAGTCAAGTCCTGTTTCTTCAGTGCC
AGTCAGCCCAGTTAACCCAAACTCCACCCCCACCATAGTG
ACCGACGGCAACGGCAACCAGTTCCTGCTGACACTGTCTA
ATCAGCACACAGAGGCCCCAGCCAGAGGCAGGCGCCCTCA
GGGCAAAGCAACCAATCAGAGCAGACTACAGAGACTGCAG
TCGACATCTACAACATTACCCAACCAATCAGAGGCTGAAT
TGCTTAATAATAACAACCAGCCCGAGCCCATACAAACTGT
CATTTTAAAACAGCCAATCAAAAAGGCACTAAAGCCAGAC
CTAAATGTGGCGACCAATTACAAGGCATCAAGCTCTTCCT
TCGTCTCAACATCATTCTTCAGTTCAGTGGATTCAATGAA
TGATGGTGATGTCGTCCCTTCATCTCCCAACAACAACAAC
AATATTGAAAATGTCTCCCAACAGCATGTTGACGACCTGT
TTGACATCCTAATCCAACGCGGAGAAATCTCTGAGAATTT
CAAAGCATCTCCTGATCCTGTTCTTGAAAGGCTTCGGCCA
AACACACCCCTCACCTTGAGCTTCTCTCCTCTCAATCTCT
CTCCTGCCTCTGAAAACACCATCAAAACTTTAATTGCAGA
ACCTCGACCTCCTTCCATCAAGGTGCCCACCAGCTGTGCC
ACAGGTGCTGGACGTCTTGAAGATTTCCTGGAAAGCACTA
CTGGCAAACCGTTACTGGGAGTGGAGCCAGGAGGACCGAC
CACGCTAATCGTAGACCTCCACAATCAAATGCTAAGCACG
CCGAGTATCCTTGACCACCCACGGTGTCCAATGGACACAT
ATGACATAAGCTTTTCCAGTCATTCTGCTTCCGATTTAGT
AGACTCCGCCCCTGATTCTATGGATTGGATGGAGCTTGGA
GTGGGCGCTTCTGCGGGGGAGGTGCCAGGGTTGGTACATA
TTAATGGACACAACCCCTCCAGCTTGTTTTCTGCAGACTT
TCTGGACACTTCTGATCTGAACTGGTCCAGCTTGTAGTCA
ATAGGAATTCACAGACTAGTCTTTTTTTTTTTTTTTTTTT
TTTAAATGGCCCACATATTTCGCATAGTAACTTCACCAGG
AACTGTTTTAATTTCGCTTTAACAAGTATGAGTTATAATA
CTAACTTTACATGGATTATATTGCATTTTAAAAAGAATCA
GTCTCTCATCTTTTCTTGCTCAAATGCTTATAGCATGTGT
ATGTCACTGAAATTATTTTATTTGTAAGTCAACCATTTTA
TCATTGAGTTTTTTTCTAAAGAGGCTAGATGTTTTATGTT
TTTCTCATTTAAAATATTGTGAATTGCTGTTACTTTAATA
TGACACCTAAATGAGATGTTTCAGTGACATACAGTACATG
TACATATGGAAACAGGCATACAAACAAGCAATATGCAAAT
CCATTTTTGCCTCAATTTTAGCAAATTTGTTTACTTGTGT
TAGTGGAGCGTTTACATTCACATTACAATTGGAATATGCG
GCAGTCAACAAGCTTGGTTTACCAAATATAATGTAAACTT
TTACATATTGCTTATTGAATATCTCGAAAATATGCACCTG
ATGGATGTAACTATTTATAGTATTATAATCTATTTTTTAT
AGCATAAGCCAACTCGTTTTGTAACATCTTGTTAGCTTTG
ACATAGGTATATTTGCATAATCGTCAAAGTTATGATAATT
AAGTTAGATCATAGGTGTTAAAGTCAATTCCCGGAGGGCC
GCATCTCTGCACAGTTATGCTCCATCTGTAATCAAACACA
GCTGATCCAAATAATCGTGGTGTTCAAAGGAATCTCTAGG
AATCGATTTTGACACCTATGAATTAGATTTTTAAAAAATG
TATACACAGATAATACTCCCATATAAGTGCCAAAATATTA
TTTTATGGCTACAAAGATAGCCAATAAGCTTGTCAATACT
TACCTGAATTATAATGCAAGAAACAGACAATGCTACTATA
TTAATCTATTTTTGATTTCAGTTTGGAAACCCATTCGAAA
TTAGCATCTGCTAGCATTGCCAAGCTTGATTATTTAACCC
CAAAGTTGAGGGTATTAACAAACTGTAATATTGTTACACC
TGCTTTCATTGTTTATAGCACCAATAACCCCCAATACACT
GTAAAAATTATTAGTTGACAAAATAAGTGAGGAAACCTTG
ATTTTTAAAGGGCACCTATTTTACCTTTTTTACAAGATGC
AAGATAAGACTTTCGTGTCTGCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations