header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-3374
Transcript Name: smurf2-201
Previous Name: smurf2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049725 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049725|OTTDARG00000034998|ZDB-GENE-030131-1830 smurf2|OTTDARP00000039007 smurf2-001 LG_ BX085195.5 Danio rerio protein_coding KNOWN, 3399 bp
TGCACATCCGGGCCACAGGACCGTGACTCCATTATTTTCT
GTTCACTGTGAAACTGGCGTTGAGGGGAACCAAAAAGCAA
CTCTGTAACACATTCGACCCGTTTTTTGTAGTAGTCAGCC
TGGATAAGGGTCAAGGACATGTCTAATCAAGGAGTTAGAA
GGAATGGACCCGTTAAGTTGCGTTTAACAGTTCTGTGCGC
TAAGAACTTGGTGAAGAAAGACTTCTTCCGGCTACCAGAT
CCTTTCGCTAAGGTGGTGGTGGATGGTTCAGGGCAGTGCC
ATTCAACAGACACAGTGAGAAATACTCTGGATCCCAAATG
GAACCAACACTATGACCTATATATCGGCAAGTCAGACTCC
ATCACCATCAGCGTGTGGAACCATAAGAAGATCCACAAGA
AACAGGGAGCGGGATTCCTGGGATGCGTACGACTCCTCTC
CAACTCTATTAACAGACTTAAGGACACAGGCTATCAGCGT
TTGGACCTGAACAAGTTAGGGCCCAATGACAGCGATACCG
TGAGGGGACAGATAGTAGTTAGTCTTCAGTCTCGGGACAG
GATAGGCAGCGGAGGGCCAGTCGTGGACTGCAGTCGTCTG
TTTGACAATGACCTGCCTGATGGCTGGGAGGAGAGGAGAA
CTGCATCTGGCCGGATCCAGTATCTGAATCATATCACACG
CAGCACCCAGTGGGAGAGACCTACCAGGCCTGCATCTGAG
TACTCAAGCCCTGGCCGGCCTCTCAGCTGCCTGGTGGATG
AAAACACACCCATCATGACACCCAACGGGGCAGCGGGTGT
ACCTGCAGACGACCCACGGGTGCAAGAGCGGAGGGTTCGC
TCTCAGAGACACAGAAACTACATGAGCAGAACTCACCTAC
ACACACCGCCTGACCTGCCAGAGGGATATGAGCAACGGAC
CACGCAGCAGGGCCAGGTCTACTTCCTGCACACACAGACA
GGCGTGAGCACATGGCATGACCCCAGAGTGCCCAGGGATC
TGAGTAATGTAAACTGTGAGGAGTTGGGTCCATTGCCCCC
GGGCTGGGAGATAAGGAACACTGCCACAGGACGAGTATAT
TTTGTGGACCACAACAACCGAACAACACAGTTCACAGATC
CACGTCTCTCTGCCAACCTGCATCTCGTCTTAAATCCCAG
TCCGAATGGCTCGCGTGCTGCAGTTGAAGCTCAGAGCAGC
AGTCGTCCCGGACAGTTGAAGGAGCAGGCTCAATCTGTCG
TGTCCCCCGGAAATCTCCCCGAGGATCCTGAATGCCTCAC
GGTGCCCAAGTACAAGAGGGATCTGGTTCAGAAGCTGAAG
ATTCTGAGACAGGAGCTGTCCCAGCAGCAGCCTCAGGCAG
GACACTGCCGCATCGAGGTCTCACGCGAGGAAATCTTTGA
GGAGTCTTACCGGCAGGTGATGAAGATGAGGCCGAAGGAC
CTGTGGAAGAGGCTGATGGTCAAATTCAGAGGAGAGGAAG
GTCTTGACTATGGTGGAGTCGCCAGGGAATGGTTATACTT
GCTGTCACACGAGATGTTAAATCCATACTATGGGCTGTTC
CAGTATTCACGAGATGACATCTACACGCTACAGATCAACC
CGGACTCGGCTGTCAATCCAGAGCATTTGTCTTATTTCCA
CTTTGTGGGGAGGATTATGGGAATGGCTGTTTTCCATGGT
CACTATATAGACGGGGGCTTCACTCTGCCCTTCTACAAGC
AGTTGCTAGGCAAACCTATCACTCTGGATGACATGGAGTC
AGTGGATCCGGACTTGCACAACAGCCTCGTCTGGATCCTA
GATAATGACATCACCGGGGTGTTGGACCACACGTTCTGCG
TTGAACACAATGCATATGGAGAGATCATTCAGCATGAGCT
CAAACCCAATGGCAAGAGCATTCCAGTCACGCAGGACACC
AAGAAGGAGTATGTGAGGCTGTATGTGAACTGGCGGTTCC
TGAGGGGCATCGAGGCTCAGTTCCTGGCCCTGCAGAAAGG
CTTCAACGAAGTCATTCCACAACACCTGCTCAAAGCGTTT
GATGAGAAAGAACTGGAGCTCATCGTGTGTGGATTGGGAA
AGATCGACATCAACGACTGGAAGTCAAACACCCGTCTGAA
GCACTGCACCCCTGACAGTAACATTGTGAAGTGGTTCTGG
AGGGCTGTGGAGTCGTATGACGAAGAGAGGAGAGCTCGAC
TGCTGCAGTTTGTCACCGGATCCTCCAGAGTTCCGCTGCA
AGGATTCAAAGCCCTGCAAGGTGCCGCTGGTCCACGTCTC
TTCACTATTCACCAGATCGATGCCAGCACCAACAACCTAC
CCAAAGCACACACTTGCTTTAACCGAATCGACATTCCTCC
ATACGAAAGCTACGATAAACTCTACGACAAGCTGCTGACA
GCCATCGAAGAGACATGCGGCTTCGCTGTGGAATGATGTC
CCACGGCAGCGCTCACACAAGACCCTTTCTCCAGACGGGA
TGGACCGGTCATCCAGACCACAGGCGTGTGGGCCTCGCGG
GGAAGCTCAGACGCTCGGGCTGAGGAACTGTGGATTACAC
CGCAGCACTCGACGCCTGATGCTGCTATCCCCATCTTTTT
GCATTATTTGAAAAGAAGAGAAGAAAACAACCTATCTTTT
CAGCTGCTAGTAACTCTTTTATTTACTATTTTGGAACCTC
CTTATCCTCCTTTTGTTTTTTGTTTTTTTAAGTCCATATT
TAGATTTTTTTTTTAGCATTAAGACGACATATTAACAGTA
TTTCATGTAGCATTTTGACAGACTAGACTTTAGGAGAGGC
TGAACTTTAGCAGGGCGCAGAACAAGAGCGGCATAAGCTA
ATGTAGAAGCACTACTGTCCTTACCGAAGACGCCAATGTC
AACAAAAGACTGCAGAGTTGGTCATTATTTTTGGGACTTG
AAGTTTTTCTTGTTGCACAGGGTGCTGATCTTGGACCCAT
TTGGATCAGGGAAATAGACTCCGCTGGCTTGTTTTTGAGT
GCCCTGCGCCGGATGCCATCTTGACTACCTGTGCTCTATT
CCAAGAGACCACCGGTGTCCGCAGTCTAGCTTTATTTTTA
TATACGCTGTGAGAGGTGAAAAATAAAAAAATATACAGAT
ATAATATATTGGCATCGTCCCAGGAATCGTTGCCGATGTT
TCCAGAGCAAAAATATTAATAAAAAAGAAGAGAGAAATGA
AGTTTAAATCAGAAAGGCAGTGAGGTTGGCATTGGCTTAC
TTTAAATGTCTGACAGGTTTTTTTTGTTTTTTAAGGAAAC
TTTTGAAGAAGAGCATTTTAATATGTTGCATTATTGGTGT
CTTTTTTTGGTAATGGATTTCGAATCTGTCTCAGATGTCA
ATCAAACCCTTTAAATGAATTAAATGCATGTCAATGAGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
smurf2-201 Contained in:
[BAC] DKEY-226A5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000049725 (1),  Ensembl_Trans:ENSDART00000055491 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC155849 (1) 3443 bp
GenBank:EL652188 (1) 926 bp
GenBank:BG728283 (1) 556 bp
GenBank:AL918929 (1) 539 bp
GenBank:EB841822 (1) 486 bp
GenBank:AI584677 (1) 484 bp
CITATIONS (2)