ZFIN ID: ZDB-TSCRIPT-131113-3319
Transcript Name: pon3.2-202
Previous Names: pon3.2-001, dkey-56f14.8-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048563 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048563|OTTDARG00000034336|ZDB-GENE-071004-70 zgc:174637|OTTDARP00000038087 DKEY-56F14.8-001 LG_ CR848666.4 Danio rerio protein_coding NOVEL, 1149 bp
GATGGATTGTATTTTGAGTGTTTCAGTCAGTCAGTATGGG
TAAGTTAGCAGTTCTCTCGTTAGTTGCTGTTGCTCTGGCA
GTATTCATCGGAGAAAGAATCGGCTCATTTAGACATTTAA
TGCTTTCCTACAGAGAACTAACCAAGAATTACCTTTCGAA
CTGCCAACTAATTACGGGCGTTGAGTTTGGGGCTGAGGAC
ATCACCATTCTTGAAGATGGATTGGCTTTTCTGAGCACTG
GCTTGAAGTATCCTGGTGTACCATACTACTCAGAAGACCC
TGGAAAGATCTATACCCTGAATCTGTTGGATTTTAAACCC
AAAATCGAATCACTGAGCATCAAAGGAGACTTTGACAAAG
ACTCTTTTAATCCACATGGAATCAGCGTGTACATCGATGA
CAAAGATGGTGCAATATACCTATTTGTTGTTAATCATCCT
CAAGGCAAAAGTCAAGTGGAGATTTTCAGATTTGTCAATC
ATGAAAATGCCCTTAAACACATCAAAACCATTAAGCATGA
ACTACTGCATAGTGTGAATGATATAGTGGCTGTGGGAACT
GAAAGCTTTTATGCCACCAATGATCATTACTTCACCAATG
ACATTCTGAAGTCTTTGGAGCTGCTTTTTTCTTTGCCGTG
GTGTGATGTGGTTTATTACAGTCCTGAGACTGTGCAGGTT
GTGGCAGGAGGATTCTTATTTGCTAACGGTATAAACATCT
CTCCTAACAAAAGGCATCTGTATGTGTCAAATTTAATGAA
ACACAAAATTACAGTATTGGAAATACAGAAAACCACTGAA
CTGTCTCACGTAAAGGAAGTTGATGTGGGATCACTCTGTG
ATAACATTGAGGTGGATCGTGAGTCTGGAGATTTGTGGCT
GGGTTGTCATCCAAACGGTTATAAATTGTTTTTTTCTGAT
CCAAATGATCCGGCTGGCTCTGAGGTAATCAAGATTGAGA
ACATCCTCTCTGAAAAGCCTAGAGTGACTCAGGTGTATTC
AGATGACGGAAGTGTGATCATCGGCTCATCAGTGGCAGCT
CCATATAGAGGAAAACTGCTCATCGGAACAGTTTATCAGA
AAGCTCTCATCTGTGACCTTAAATAGTGATACTTACAAAT
GAACATTAATAATAAAAATTCTTTGAAAG

pon3.2 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript pon3.2-203 (1)    Ensembl 493
mRNA pon3.2-202 1149
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pon3.2-202 Contained in:
[BAC] DKEY-56F14 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000048563 (1),  Ensembl_Trans:ENSDART00000058959 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC152247 (1) 1146 nt
GenBank:BC164397 (1) 1138 nt
GenBank:EH569777 (1) 923 nt
GenBank:EB787353 (1) 590 nt
GenBank:CB365732 (1) 422 nt
CITATIONS (2)