ZFIN ID: ZDB-TSCRIPT-131113-128
Transcript Name: pon3.2-203
Previous Names: pon3.2-002, dkey-56f14.8-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048564 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048564|OTTDARG00000034336|ZDB-GENE-071004-70 zgc:174637|OTTDARP00000038088 DKEY-56F14.8-002 LG_ CR848666.4 Danio rerio protein_coding NOVEL, 493 bp
TTTAATGAAACACAAAATTACAGTATTGGAAATACAGAAA
ACCACTGAACTGTCTCACGTAAAGATGCAGCTGCAGCACA
GCTCTGAATCGCTGAGAACTTGTCAGTGAACAATTGCGCT
TCTGTAGTAAATGCTCCATCTGAGGCCGTGTGCATACGAA
CATGGGAAGTTGATGTGGGATCACTCTGTGATAACATTGA
GGTGGATCGTGAGTCTGGAGATTTGTGGCTGGGTTGTCAT
CCAAACGGTTATAAATTGTTTTTTTCTGATCCAAATGATC
CGGCTGGCTCTGAGGTAATCAAGATTGAGAACATCCTCTC
TGAAAAGCCTAGAGTGACTCAGGTGTATTCAGATGACGGA
AGTGTGATCATCGGCTCATCAGTGGCAGCTCCATATAGAG
GAAAACTGCTCATCGGAACAGTTTATCAGAAAGCTCTCAT
CTGTGACCTTAAATAGTGATACTTACAAATGAACATTAAT
AATAAAAATTCTT

pon3.2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA pon3.2-202 (1) 1149
aberrant processed transcript pon3.2-203 493
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pon3.2-203 Contained in:
OTHER pon3.2-203 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000048564 (1)
  • Ensembl_Trans:ENSDART00000154636 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BQ284327 (1) 493bp
    CITATIONS (2)