ZFIN ID: ZDB-TSCRIPT-131113-128
Transcript Name: pon3.2-203
Previous Names: pon3.2-002, dkey-56f14.8-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048564 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048564|OTTDARG00000034336|ZDB-GENE-071004-70 zgc:174637|OTTDARP00000038088 DKEY-56F14.8-002 LG_ CR848666.4 Danio rerio protein_coding NOVEL, 493 bp
TTTAATGAAACACAAAATTACAGTATTGGAAATACAGAAA
ACCACTGAACTGTCTCACGTAAAGATGCAGCTGCAGCACA
GCTCTGAATCGCTGAGAACTTGTCAGTGAACAATTGCGCT
TCTGTAGTAAATGCTCCATCTGAGGCCGTGTGCATACGAA
CATGGGAAGTTGATGTGGGATCACTCTGTGATAACATTGA
GGTGGATCGTGAGTCTGGAGATTTGTGGCTGGGTTGTCAT
CCAAACGGTTATAAATTGTTTTTTTCTGATCCAAATGATC
CGGCTGGCTCTGAGGTAATCAAGATTGAGAACATCCTCTC
TGAAAAGCCTAGAGTGACTCAGGTGTATTCAGATGACGGA
AGTGTGATCATCGGCTCATCAGTGGCAGCTCCATATAGAG
GAAAACTGCTCATCGGAACAGTTTATCAGAAAGCTCTCAT
CTGTGACCTTAAATAGTGATACTTACAAATGAACATTAAT
AATAAAAATTCTT

pon3.2 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript pon3.2-203 493
mRNA pon3.2-202 (1)    Ensembl 1149
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pon3.2-203 Contained in:
[BAC] DKEY-56F14 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000048564 (1),  Ensembl_Trans:ENSDART00000154636 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BQ284327 (1) 493 nt
CITATIONS (2)