header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-3290
Transcript Name: rab42b-002
Previous Name: dkey-34d22.4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047748 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047748|OTTDARG00000033872|ZDB-GENE-050417-172 rab42b|no_translation DKEY-34D22.4-002 LG_ CR936484.5 Danio rerio protein_coding NOVEL, 1306 bp
CAAGGTCTTTGGTATCCTAAAAACTTCCAGTGTTGAGACA
AGTTCTCTGTAGAAAAACAGCCCTCCACGACAGTTTTGGA
CATTCTTGCCTAAATACCAATACTTAAGGTCAGGGGTTTT
CAGTCCTGCTTTTGGAGAATGAGTGGCATCAATTTAAGCT
TAAGCCTGCCCCAACGCACCTGTCAGGAAGTTTTATGCTA
ACCTTGATTAGCTGGTTTATGGGTGTTTATTTTGGCTTGA
AGTTAAACTTTGGTCGACATCAGAATACTCCTGCTCAAGA
TTTGGTTGATTTGTAGACAACTTTAGTGTGTTTAGTCATA
TGTTCATTGTCTAAAAACAGTTTACAGAAGTTGCGTTGCT
TCTGTGAATCAGGATTGTGAAACATGACTCGTCACAGCAG
CAAGTCTTCTCATGAAGCTTCCAAGAAAAATGTTGTCAGT
CTACACAATAAATGGAATCACTGCCAGGCCCGAGTCCACT
GGGGTGGGGTTCCACTTAATTGGCCCACACTGTAAACCAC
GCCAACTGTTCGGCCCACCCGGAGAGGCCCAAGGACCAAC
TAACATCAGAGACCTGGAGTTAGGCTGGTTCGTTGGTATG
CACAGATGACCTTACAGAGCCAGCTCACCCAAAAAGGAAA
ATTCTTTCATCATTTACTCAAACAAAGAGTCATGGGTGGT
CTGTGACTCGATCCTACTACCGTAACTCTGTTGGAGGTCT
CCTGGTGTTCGATCTGGGCAATCGCAAATCTTTTGAAAAT
GTGCGGGAATGGTACGCTGAGGTGTGTGAACGTGTGCATC
CCTATACTGTGCTCTTCGTCCTGGTGGGACACAAGAGCGA
CCGCGTCAAAGGTGGAGAAAGAGCCGTGGACCGAACTGAA
GCAGAAAAGTTGGCGAGCCAGCTGGGAGCCCCCTACATCG
AGGCCTCGGCCAAAACGGGTCACAATGTGAAAGAAGCCTT
CGACCTCTTGACCCGGCGGATTTATCAGGGCTTAAAAAGT
GGCGAGATCCAGTTGCGCGAAGGGTGGGATGGCGTCAAAA
GCTCAGCGCCTACAGCCCAAACCCTCCAGAAGTTACAAAA
CAATGAATCTGCTGAGAAAAAGAGCTGTACCTGTTAACTA
TTACAACACGTGGCTCTGTGTTTCAAAAGGATGGATACGT
TTGACATTGCCCAATACACCTAAAAGTAAACCTCAAAGAC
TTGATGCAAGATTGTAGGTGTTAAATTCTACATAACATAT
GCACGATTTCAGAATTTGGAAACCAAATTGGAACTCTTGA
TTAAAGTCATTACCATACACGTTTCC

rab42b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rab42b-002 1306
mRNA rab42b-202 (1) 1030
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rab42b-002 Contained in:
[BAC] DKEY-34D22 (1) (order this)

OTHER rab42b-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000047748 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH554404 (1) 955 bp
    GenBank:EH575517 (1) 939 bp
    CITATIONS (1)