ZFIN ID: ZDB-TSCRIPT-131113-3256
Transcript Name: stt3a-201
Previous Names: itm1-001, stt3a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000046081 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000046081|OTTDARG00000032911|ZDB-GENE-021015-3 stt3a|OTTDARP00000036361 itm1-001 LG_ CU633886.9 Danio rerio protein_coding KNOWN, 2071 bp
TTTAAACGCAGAGAGGGTTGTGTGTGAAAGTGTGGAAGGG
CTGGAGTGAGTGAACCGCCGATGAATAAGACTGGTGTCAA
GAGTTAGTCCTGCCTCCCGTGTGTAAAGATGACCAAGCTG
GGCTTCCTGCGTCTGTCCTATGAGAAACAGGACACCCTGC
TGAAGCTGCTCATCCTGTCTATGGCAGCCGTCCTGTCCTT
CTCCACCAGACTGTTTTCTGTGCTTCGGTTCGAGAGCGTC
ATCCACGAGTTTGATCCGTATTTCAATTACCGGACCACTC
GCTTCCTGGCAGAAGAGGGATTTTACAAATTCCATAACTG
GTTCGATGATCGGGCTTGGTATCCACTTGGGAGGATTATT
GGAGGCACCATCTATCCTGGGTTGATGATCACATCAGCAG
CTCTATATCACGTGCTGCACTTCTTCCACATCACCATTGA
CATCCGTAATGTCTGTGTGTTCCTCGCTCCTCTCTTCTCC
TCCTTCACCGCTATCGTCACTTACCACTTCACCAAAGAGC
TGAAGGATGCAGGCGCTGGGCTTCTGGCTGCCGCTATGAT
CGCAGTCGTGCCTGGATACATCTCCCGTTCTGTGGCAGGC
TCTTATGATAATGAAGGAATTGCCATTTTCTGCATGCTGT
TGACGTACTACATGTGGATCAAGGCAGTGAAGTCGGGCTC
CATTTATTGGTCATCCATGTGTGCATTGGCATATTTTTAC
ATGGTGTCCTCCTGGGGTGGTTACGTGTTTCTGATTAACC
TCATTCCTCTGCACGTGCTGGTGTTGATGCTCACCGGCCG
GTTCTCTCATCGCATCTATGTGGCCTACTGCACAGTCTAC
TGCCTGGGCACCATCCTCTCCATGCAGATCTCTTTTGTTG
GATTCCAGCCCGTCCAGTCCTCTGAACACATGGCTGCTTT
TGGAGTGTTTGGTCTGTGCCAGATTCACGCTTTTGTCGAT
TACCTGCGGAGCAAACTGAACGCGCAGCAGTTTGAGGTGT
TGTTCAGGAGTGTCATTTCACTGGTCGGGATCATCCTGCT
GTCTGTGGGCGGGTTGCTCATGCTGACAGGAAAAATCTCA
CCTTGGACTGGCCGTTTCTACTCTCTGCTGGATCCATCGT
ACGCCAAAAACAACATTCCCATCATCGCCTCTGTGTCTGA
GCATCAGCCCACCACATGGTCCTCCTACTACTTTGACCTC
CAGCTTCTGGTCTTCATGTTTCCAGTTGGCCTTTACTACT
GCTTCAACAACCTCTCTGATGCCACGATTTTCATCATCAT
GTATGGCGTCACCAGCATGTACTTCTCAGCTGTGATGGTG
CGTCTCATGTTGGTCCTCGCTCCAGTAATGTGCATCCTGT
CTGGCATTGGAGTCTCTCAGGTCCTCACCACCTTCATGAA
GAACCTGGATGTCAGTCGACCTGACAAGAAAACCAAGAAG
CAGCAGGACTCCACCTACCCAATCAAGAACGAAGTGGCAA
GTGGGATGATTCTAGTGATGGCGTTCTTCCTCATCACATA
CACTTTCCACTCCACCTGGGTGACCAGCGAGGCGTATTCG
TCCCCCTCCATCGTGCTTTCTGCTCGCGGTGGCGACGGCA
GCCGCATCATCTTTGATGACTTCAGAGAGGCTTATTACTG
GCTCAGACACAACACACCAGAGGATGCTAAAGTGATGTCG
TGGTGGGATTATGGGTATCAGATAACAGCGATGGCCAATC
GAACGATTCTGGTTGACAATAACACTTGGAATAACACTCA
CATCTCCAGAGTGGGTCAGGCAATGGCCTCCACAGAGGAG
AAAGCCTATGAGATTATGCGAGAGCTGGATGTGAGCTACG
TCCTGGTGATCTTTGGCGGATTGACCGGATATTCATCTGA
TGATATTAATAAGTTCCTGTGGATGGTGCGTATCGGTGGC
AGCACAGACACAGGGAGGCACATAAAGGAGCACGATTATT
ACACGCCCACTGGAGAGTTTCGTGTGGACCGCGAGGGCTC
TCCTGTCCTGCTCAACTGCCTCATGTACAAGATGTGCTAC
TATCGCTTCGGCCAGGTCTACACCGAAGCCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
stt3a-201 Contained in:
[Fosmid] CH1073-74N1 (1)

Genome Resources: Vega_Trans:OTTDART00000046081 (1),  Ensembl_Trans:ENSDART00000159501 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC046072 (1) 2608 bp
GenBank:BC063234 (1) 2567 bp
CITATIONS (2)