Transcript

cuzd1.2-002

ID
ZDB-TSCRIPT-131113-3246
Name
cuzd1.2-002
Previous Names
  • ch211-208g24.6-002
  • si:ch211-208g24.6-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042446 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042446|OTTDARG00000030615|ZDB-GENE-131119-30 cuzd1.2|no_translation CH211-208G24.6-002 LG_ AL773596.12 Danio rerio protein_coding NOVEL, 928 bp
GTGTGATCTATGTGTCTCGACAGCTTCTCATCAGCTTTTA
ATACTTAAATTTGCTTTGTCAGTTTGATAAATGTGTGCGT
TGTTGAGAGCCGTGTTTGCCACACAACATCACCCACTCTC
CGTCTCTCTTTCCCTTTAGATGATGAACAGTTTTGTGTCC
TACACCAACAATGTGCGGGCATCTCCTTCTCAGTCGGGTG
TAATCACTCGTCAGTCAGAGTTTCTCCTGAGTGTGGGCTG
CCGAATGGAGCCGGACACTATTGTGCAGATCTTCTACAAG
GCCGAAGAAATCCCCAATGGCAACATCACAGGAACGGGCC
GCTTCAATGCCAGCATTGCCTTCTACACCTCCAGAAAGTT
CAACCAGCAGATTTACGACTCTCCATATGAAGTGTACCTG
AATGACGATCTGTTTGTTCAAGTCAAGCTAACCAGATTTG
ATGCAAGCCTGGATCTCTTCTTGGAGACTTGCGTAGCATC
TCCAAATCCAAATGACTTTAAAGATTATTCCTATGACCTG
CTGCGTAATGGATGTCCCAGAGACAGCACATTTCAATCCT
ATATCAATGGCGTGGATCAATATGCTCAGTTCAGTTTCCG
GGCTTTCAAGTTCCTCCAGACTCATGCCTATGTGCACCTG
CAGTGTCAGGTGATCATCTGCCCTGATAATGATTACAACT
CTCGCTGCCGTAAAGGTTGCCAATACCGGCGCAAGAGATC
CCTTGACAGCTCCTACAACACCAGTACTGTGACGCTGGGC
CCGATCAAACTCAGAGGTCAGTGATCAGACAGCTGTTCAG
ACAACAAGAGAAGATTAAGGCAGCAGAGTGGTTTTTATCA
TCATCAGCAACTTTATTTCTCATCTCTATGATTAATTAGA
CCACATCATCCTACCTAATGATGTACCTTCTTTAATTCAT
TAAAGCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations