ZFIN ID: ZDB-TSCRIPT-131113-3246
Transcript Name: cuzd1.2-002
Previous Names: ch211-208g24.6-002, si:ch211-208g24.6-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042446 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042446|OTTDARG00000030615|ZDB-GENE-131119-30 cuzd1.2|no_translation CH211-208G24.6-002 LG_ AL773596.12 Danio rerio protein_coding NOVEL, 928 bp
GTGTGATCTATGTGTCTCGACAGCTTCTCATCAGCTTTTA
ATACTTAAATTTGCTTTGTCAGTTTGATAAATGTGTGCGT
TGTTGAGAGCCGTGTTTGCCACACAACATCACCCACTCTC
CGTCTCTCTTTCCCTTTAGATGATGAACAGTTTTGTGTCC
TACACCAACAATGTGCGGGCATCTCCTTCTCAGTCGGGTG
TAATCACTCGTCAGTCAGAGTTTCTCCTGAGTGTGGGCTG
CCGAATGGAGCCGGACACTATTGTGCAGATCTTCTACAAG
GCCGAAGAAATCCCCAATGGCAACATCACAGGAACGGGCC
GCTTCAATGCCAGCATTGCCTTCTACACCTCCAGAAAGTT
CAACCAGCAGATTTACGACTCTCCATATGAAGTGTACCTG
AATGACGATCTGTTTGTTCAAGTCAAGCTAACCAGATTTG
ATGCAAGCCTGGATCTCTTCTTGGAGACTTGCGTAGCATC
TCCAAATCCAAATGACTTTAAAGATTATTCCTATGACCTG
CTGCGTAATGGATGTCCCAGAGACAGCACATTTCAATCCT
ATATCAATGGCGTGGATCAATATGCTCAGTTCAGTTTCCG
GGCTTTCAAGTTCCTCCAGACTCATGCCTATGTGCACCTG
CAGTGTCAGGTGATCATCTGCCCTGATAATGATTACAACT
CTCGCTGCCGTAAAGGTTGCCAATACCGGCGCAAGAGATC
CCTTGACAGCTCCTACAACACCAGTACTGTGACGCTGGGC
CCGATCAAACTCAGAGGTCAGTGATCAGACAGCTGTTCAG
ACAACAAGAGAAGATTAAGGCAGCAGAGTGGTTTTTATCA
TCATCAGCAACTTTATTTCTCATCTCTATGATTAATTAGA
CCACATCATCCTACCTAATGATGTACCTTCTTTAATTCAT
TAAAGCAA

cuzd1.2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cuzd1.2-203 (1)    Ensembl 2324
ncRNA cuzd1.2-002 928
cuzd1.2-003 (1)    Ensembl 714
cuzd1.2-004 (1)    Ensembl 222
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cuzd1.2-002 Contained in:
[BAC] CH211-208G24 (1)

Genome Resources: Vega_Trans:OTTDART00000042446 (1),  Ensembl_Trans:ENSDART00000153819 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH492840 (1) 954 nt
CITATIONS (2)