ZFIN ID: ZDB-TSCRIPT-131113-1646
Transcript Name: cuzd1.2-004
Previous Names: ch211-208g24.6-004, si:ch211-208g24.6-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000042448 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000042448|OTTDARG00000030615|ZDB-GENE-131119-30 cuzd1.2|no_translation CH211-208G24.6-004 LG_ AL773596.12 Danio rerio protein_coding NOVEL, 222 bp
GATCCCTTGACAGCTCCTACAACACCAGTACTGTGACGCT
GGGCCCGATCAAACTCAGAGGTCAGTGATCAGACAGCTGT
TCAGACAACAAGAGAAGATTAAGGCAGCAGAGTGGTTTTT
ATCATCATCAGCAACTTTATTTCTCATCTCTATGATTAAT
TAGACCACATCATCCTACCTAATGATGTACCTTCTTTAAT
TCATTAAAGCAATCCTTCTTCC

cuzd1.2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cuzd1.2-203 (1)    Ensembl 2324
ncRNA cuzd1.2-002 (1)    Ensembl 928
cuzd1.2-003 (1)    Ensembl 714
cuzd1.2-004 222
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cuzd1.2-004 Contained in:
[BAC] CH211-208G24 (1)

Genome Resources: Vega_Trans:OTTDART00000042448 (1),  Ensembl_Trans:ENSDART00000154629 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL922924 (1) 221 nt
CITATIONS (2)