Transcript

cuzd1.2-004

ID
ZDB-TSCRIPT-131113-1646
Name
cuzd1.2-004
Previous Names
  • ch211-208g24.6-004
  • si:ch211-208g24.6-004
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000042448 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000042448|OTTDARG00000030615|ZDB-GENE-131119-30 cuzd1.2|no_translation CH211-208G24.6-004 LG_ AL773596.12 Danio rerio protein_coding NOVEL, 222 bp
GATCCCTTGACAGCTCCTACAACACCAGTACTGTGACGCT
GGGCCCGATCAAACTCAGAGGTCAGTGATCAGACAGCTGT
TCAGACAACAAGAGAAGATTAAGGCAGCAGAGTGGTTTTT
ATCATCATCAGCAACTTTATTTCTCATCTCTATGATTAAT
TAGACCACATCATCCTACCTAATGATGTACCTTCTTTAAT
TCATTAAAGCAATCCTTCTTCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations